920 resultados para Monitoring of Structures


Relevância:

100.00% 100.00%

Publicador:

Resumo:

The growing demand for lightweight solutions in every field of engineering is driving the industry to seek new technological solutions to exploit the full potential of different materials. The combination of dissimilar materials with distinct property ranges embodies a transparent allocation of component functions while allowing an optimal mix of their characteristics. From both technological and design perspectives, the interaction between dissimilar materials can lead to severe defects that compromise a multi-material hybrid component's performance and its structural integrity. This thesis aims to develop methodologies for designing, manufacturing, and monitoring of hybrid metal-composite joints and hybrid composite components. In Chapter 1, a methodology for designing and manufacturing hybrid aluminum/composite co-cured tubes is assessed. In Chapter 2, a full-field methodology for fiber misalignment detection and stiffness prediction for hybrid, long fiber reinforced composite systems is shown and demonstrated. Chapter 3 reports the development of a novel technology for joining short fiber systems and metals in a one-step co-curing process using lattice structures. Chapter 4 is dedicated to a novel analytical framework for the design optimization of two lattice architectures.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Industrial companies, particularly those with induction motors and gearboxes as integral components of their systems, are utilizing Condition Monitoring (CM) systems more frequently in order to discover the need for maintenance in advance, as traditional maintenance only performs tasks when a failure has been identified. Utilizing a CM system is essential to boost productivity and minimize long-term failures that result in financial loss. The more exact and practical the CM system, the better the data analysis, which adds to a more precise maintenance forecast. This thesis project is a cooperation with PEI Vibration Monitoring s.r.l. to design and construct a low-cost vibrational condition monitoring system to check the health of induction motors and gearboxes automatically. Moreover, according to the company's request, such a system should have specs comparable to NI 9234, one of the company's standard Data Acquisition (DAQ) boards, but at a significantly cheaper price. Additionally, PEI VM Company has supplied all hardware and electronic components. The suggested CM system is capable of highprecision autonomous monitoring of induction motors and gearboxes, and it consists of a Raspberry Pi 3B and MCC 172 DAQ board.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Ozone and inhalable particulate matter are the major air pollutants in the Metropolitan Area of São Paulo, Brazil, a region that has more than 19 million inhabitants and approximately 7 million registered vehicles. Proximity of roadways, adjacent land use, and local circulation are just some of the factors that can affect the results of monitoring of pollutant concentrations. The so-called weekend effect (higher ozone concentrations on weekends than on weekdays) might be related to the fact that concentrations of ozone precursors, such as nitrogen oxides (NOx) and Non Methane-Hydrocarbon (NMHC), are relatively lower on weekends. This phenomenon has been reported in some areas of the United States since the 1970s. The differences between the concentrations of ozone in period of weekend and weekday, were obtained from analysis of data hourly average of CETESB for 2004, studied the precursors to the formation of troposphere ozone, the meteorological variables and traffic profile for RMSP. Because of the proximity to sources of emissions from the station Pinheiros showed higher concentrations of NO and NO² and greater variations to the periods weekend and weekday. With fewer vehicles circulating during the weekend, and consequently less emission of pollutants, it has cleaner air and less concentration of NO and NO², there is the ideal setting to the formation of troposphere ozone, despite the lower concentration of NO². The proximity with the source emissions, aided by the increased availability of solar radiation and the presence of ozone precursors, were factors conditions for the occurrence of weekend effect.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

In the Brazilian Cerrado (neotropical savanna), the development of bud-bearing underground systems as adaptive structures to fire and dry periods can comprise an important source of buds for this ecosystem, as already demonstrated in the Brazilian Campos grasslands and North American prairies. Asteraceae species from both woody and herbaceous strata have subterranean organs that accumulate carbohydrates, reinforcing the adaptive strategy of these plants to different environmental conditions. This study aims to analyse the morpho-anatomy of underground systems of six species of Asteraceae (Mikania cordifolia L.f. Willd., Mikania sessilifolia DC, Trixis nobilis (Vell.) Katinas, Pterocaulon alopecuroides (Lam.) DC., Vernonia elegans Gardner and Vernonia megapotamica Spreng.), to describe these structures and to verify the occurrence and origin of shoot buds, and to analyse the presence of reserve substances. Individuals sampled in Cerrado areas in São Paulo State showed thick underground bud-bearing organs, with adventitious or lateral roots and presence of fructans. Xylopodium was found in all studied species, except for Trixis nobilis, which had stem tuber. The presence of fructans as reserve, and the capacity of structures in the formation of buds indicate the potential of herbaceous species of Asteraceae in forming a viable bud bank for vegetation regeneration in the Brazilian Cerrado.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

The structural engineering community in Brazil faces new challenges with the recent occurrence of high intensity tornados. Satellite surveillance data shows that the area covering the south-east of Brazil, Uruguay and some of Argentina is one of the world most tornado-prone areas, second only to the infamous tornado alley in central United States. The design of structures subject to tornado winds is a typical example of decision making in the presence of uncertainty. Structural design involves finding a good balance between the competing goals of safety and economy. This paper presents a methodology to find the optimum balance between these goals in the presence of uncertainty. In this paper, reliability-based risk optimization is used to find the optimal safety coefficient that minimizes the total expected cost of a steel frame communications tower, subject to extreme storm and tornado wind loads. The technique is not new, but it is applied to a practical problem of increasing interest to Brazilian structural engineers. The problem is formulated in the partial safety factor format used in current design codes, with all additional partial factor introduced to serve as optimization variable. The expected cost of failure (or risk) is defined as the product of a. limit state exceedance probability by a limit state exceedance cost. These costs include costs of repairing, rebuilding, and paying compensation for injury and loss of life. The total expected failure cost is the sum of individual expected costs over all failure modes. The steel frame communications, tower subject of this study has become very common in Brazil due to increasing mobile phone coverage. The study shows that optimum reliability is strongly dependent on the cost (or consequences) of failure. Since failure consequences depend oil actual tower location, it turn,,; out that different optimum designs should be used in different locations. Failure consequences are also different for the different parties involved in the design, construction and operation of the tower. Hence, it is important that risk is well understood by the parties involved, so that proper contracts call be made. The investigation shows that when non-structural terms dominate design costs (e.g, in residential or office buildings) it is not too costly to over-design; this observation is in agreement with the observed practice for non-optimized structural systems. In this situation, is much easier to loose money by under-design. When by under-design. When structural material cost is a significant part of design cost (e.g. concrete dam or bridge), one is likely to lose significantmoney by over-design. In this situation, a cost-risk-benefit optimization analysis is highly recommended. Finally, the study also shows that under time-varying loads like tornados, the optimum reliability is strongly dependent on the selected design life.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

The feasibility of using constructed wetlands (CWs) for the mitigation of pesticide runoff has been studied in the last decade. However, a lack of related data was verified when subsurface flow constructed wetlands (SSF CWs) are considered for this purpose. In the present work, SSF CWs were submitted to continuous ametryn addition and evaluated during an I I-week period, with the aim of determining the feasibility of these systems for mitigation of contaminated water. Ametryn was not added to one CW cell in order to provide a control for the experiments. Monitoring of treatment performance was executed by standard water quality parameters, ametryn chromatography quantification and macrophyte (Typha latifolia L) nutritional and agronomic property analysis. Results indicated that 39% of the total initially added amount of ametryn was removed, transferred or transformed. Herbicide metabolism and mineralisation were carried out by chemical and biological mechanisms. No statistic differences were observed in nutritional contents found in the T. latifolia crops of the CWs after the experimental period. Moreover, the biomass production (one valuable source of renewable energy) was equal to 3.3 t.ha(-1) (dry matter) in wetland cells. It was concluded that constructed wetland systems are capable of mitigating water contaminated with ametryn, acting as buffer filters between the emission sources and the downstream superficial water bodies.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Background: Since establishing universal free access to antiretroviral therapy in 1996, the Brazilian Health System has increased the number of centers providing HIV/AIDS outpatient care from 33 to 540. There had been no formal monitoring of the quality of these services until a survey of 336 AIDS health centers across 7 Brazilian states was undertaken in 2002. Managers of the services were asked to assess their clinics according to parameters of service inputs and service delivery processes. This report analyzes the survey results and identifies predictors of the overall quality of service delivery. Methods: The survey involved completion of a multiple-choice questionnaire comprising 107 parameters of service inputs and processes of delivering care, with responses assessed according to their likely impact on service quality using a 3-point scale. K-means clustering was used to group these services according to their scored responses. Logistic regression analysis was performed to identify predictors of high service quality. Results: The questionnaire was completed by 95.8% (322) of the managers of the sites surveyed. Most sites scored about 50% of the benchmark expectation. K-means clustering analysis identified four quality levels within which services could be grouped: 76 services (24%) were classed as level 1 (best), 53 (16%) as level 2 (medium), 113 (35%) as level 3 (poor), and 80 (25%) as level 4 (very poor). Parameters of service delivery processes were more important than those relating to service inputs for determining the quality classification. Predictors of quality services included larger care sites, specialization for HIV/AIDS, and location within large municipalities. Conclusion: The survey demonstrated highly variable levels of HIV/AIDS service quality across the sites. Many sites were found to have deficiencies in the processes of service delivery processes that could benefit from quality improvement initiatives. These findings could have implications for how HIV/AIDS services are planned in Brazil to achieve quality standards, such as for where service sites should be located, their size and staffing requirements. A set of service delivery indicators has been identified that could be used for routine monitoring of HIV/AIDS service delivery for HIV/AIDS in Brazil (and potentially in other similar settings).

Relevância:

90.00% 90.00%

Publicador:

Resumo:

The efficacy of photodynamic therapy (PDT) depends on a variety of parameters: concentration of the photosensitizer at the time of treatment, light wavelength, fluence, fluence rate, availability of oxygen within the illuminated volume, and light distribution in the tissue. Dosimetry in PDT requires the congregation of adequate amounts of light, drug, and tissue oxygen. The adequate dosimetry should be able to predict the extension of the tissue damage. Photosensitizer photobleaching rate depends on the availability of molecular oxygen in the tissue. Based on photosensitizers photobleaching models, high photobleaching has to be associated with high production of singlet oxygen and therefore with higher photodynamic action, resulting in a greater depth of necrosis. The purpose of this work is to show a possible correlation between depth of necrosis and the in vivo photosensitizer (in this case, Photogem (R)) photodegradation during PDT. Such correlation allows possibilities for the development of a real time evaluation of the photodynamic action during PDT application. Experiments were performed in a range of fluence (0-450 J/cm(2)) at a constant fluence rate of 250 mW/cm(2) and applying different illumination times (0-1800 s) to achieve the desired fluence. A quantity was defined (psi) as the product of fluorescence ratio (related to the photosensitizer degradation at the surface) and the observed depth of necrosis. The correlation between depth of necrosis and surface fluorescence signal is expressed in psi and could allow, in principle, a noninvasive monitoring of PDT effects during treatment. High degree of correlation is observed and a simple mathematical model to justify the results is presented.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Background: Large inequalities of mortality by most cancers in general, by mouth and pharynx cancer in particular, have been associated to behaviour and geopolitical factors. The assessment of socioeconomic covariates of cancer mortality may be relevant to a full comprehension of distal determinants of the disease, and to appraise opportune interventions. The objective of this study was to compare socioeconomic inequalities in male mortality by oral and pharyngeal cancer in two major cities of Europe and South America. Methods: The official system of information on mortality provided data on deaths in each city; general censuses informed population data. Age-adjusted death rates by oral and pharyngeal cancer for men were independently assessed for neighbourhoods of Barcelona, Spain, and Sao Paulo, Brazil, from 1995 to 2003. Uniform methodological criteria instructed the comparative assessment of magnitude, trends and spatial distribution of mortality. General linear models assessed ecologic correlations between death rates and socioeconomic indices (unemployment, schooling levels and the human development index) at the inner-city area level. Results obtained for each city were subsequently compared. Results: Mortality of men by oral and pharyngeal cancer ranked higher in Barcelona (9.45 yearly deaths per 100,000 male inhabitants) than in Spain and Europe as a whole; rates were on decrease. Sao Paulo presented a poorer profile, with higher magnitude (11.86) and stationary trend. The appraisal of ecologic correlations indicated an unequal and inequitably distributed burden of disease in both cities, with poorer areas tending to present higher mortality. Barcelona had a larger gradient of mortality than Sao Paulo, indicating a higher inequality of cancer deaths across its neighbourhoods. Conclusion: The quantitative monitoring of inequalities in health may contribute to the formulation of redistributive policies aimed at the concurrent promotion of wellbeing and social justice. The assessment of groups experiencing a higher burden of disease can instruct health services to provide additional resources for expanding preventive actions and facilities aimed at early diagnosis, standardized treatments and rehabilitation.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Long-term assessments of species assemblages are valuable tools for detecting species ecological preferences and their dispersal tracks, as well as for assessing the possible effects of alien species on native communities. Here we report a 50-year-long study on population dynamics of the four species of land flatworms (Platyhelminthes, Tricladida, Terricola) that have colonized or become extinct in a 70-year-old Atlantic Forest regrowth remnant through the period 1955-2006. On the one hand, the two initially most abundant species, which are native to the study site, Notogynaphallia ernesti and Geoplana multicolor have declined over decades and at present do not exist in the forest remnant. The extinction of these species is most likely related with their preference for open vegetation areas, which presently do not exist in the forest remnant. On the other hand, the neotropical Geoplaninae 1 and the exotic Endeavouria septemlineata were detected in the forest only very recently. The long-term study allowed us to conclude that Geoplaninae 1 was introduced into the study area, although it is only known from the study site. Endeavouria septemlineata, an active predator of the exotic giant African snail, is originally known from Hawaii. This land flatworm species was observed repeatedly in Brazilian anthropogenic areas, and this is the first report of the species in relatively well preserved native forest, which may be evidence of an ongoing adaptive process. Monitoring of its geographic spread and its ecological role would be a good practice for preventing potential damaging effects, since it also feeds on native mollusk fauna, as we observed in lab conditions.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

The specific methanogenic activity (SMA) test is an important tool for the monitoring of anaerobic digestion. This paper presents the behavior of the methanogenic archaea of an anaerobic sludge under different conditions of oxygenation in a fixed-bed anaerobic-aerobic reactor treating domestic sewage. The reactor was operated in a continuous manner under different liquid recycle ratios from aerobic to anaerobic zones in order to remove carbon and nitrogen. The application of the SMA test was adapted from several authors and the measurement of the accumulated methane in the reactor was carried out by means of gas chromatography. Methanogenic organisms were not inhibited by the presence of oxygen. In contrast, the values of CH, production rate by sludge exposed to oxygen were greater than those obtained for strictly anaerobic sludge.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

By allowing the estimation of forest structural and biophysical characteristics at different temporal and spatial scales, remote sensing may contribute to our understanding and monitoring of planted forests. Here, we studied 9-year time-series of the Normalized Difference Vegetation Index (NDVI) from the Moderate Resolution Imaging Spectroradiometer (MODIS) on a network of 16 stands in fast-growing Eucalyptus plantations in Sao Paulo State, Brazil. We aimed to examine the relationships between NDVI time-series spanning entire rotations and stand structural characteristics (volume, dominant height, mean annual increment) in these simple forest ecosystems. Our second objective was to examine spatial and temporal variations of light use efficiency for wood production, by comparing time-series of Absorbed Photosynthetically Active Radiation (APAR) with inventory data. Relationships were calibrated between the NDVI and the fractions of intercepted diffuse and direct radiation, using hemispherical photographs taken on the studied stands at two seasons. APAR was calculated from the NDVI time-series using these relationships. Stem volume and dominant height were strongly correlated with summed NDVI values between planting date and inventory date. Stand productivity was correlated with mean NDVI values. APAR during the first 2 years of growth was variable between stands and was well correlated with stem wood production (r(2) = 0.78). In contrast, APAR during the following years was less variable and not significantly correlated with stem biomass increments. Production of wood per unit of absorbed light varied with stand age and with site index. In our study, a better site index was accompanied both by increased APAR during the first 2 years of growth and by higher light use efficiency for stem wood production during the whole rotation. Implications for simple process-based modelling are discussed. (C) 2009 Elsevier B.V. All rights reserved.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Optical microscopy and centrifugation were used to observe the Structural changes during evaporation of a commercial skin lotion of unknown composition. The degree of evaporation was determined from the changed weight of a microscope slide with the emulsion on a defined area and thickness, the evaporation loss versus time being measured by a balance under an infrared lamp. The results revealed not only which parts of the emulsion were most prone to evaporation without chemical analysis, but also gave surprising information as to which kind of structures would appear after extensive evaporation. The importance of these changes for the action of a skin lotion is briefly discussed.