990 resultados para Mitek mini anchor


Relevância:

10.00% 10.00%

Publicador:

Resumo:

Objectifs: Relater notre expérience des herniectomies sous guidage scanner des conflits disco-radiculaires résistants au traitement médical et aux infiltrationsradio-guidées. Decrire les techniques, indications, contre-indications et limites de ces procédures. Matériels et méthodes: De janvier 2004 à janvier 2011, plus de 1000 herniectomies ont été réalisées dans notre institution. L'intervention se déroule en salle de scanner interventionnelavec arceau de scopie. Ce guidage permet de positionner le matériel d'extraction exactement dans la hernie discale. Résultats: Les herniectomies sont réalisées lorsque l'indication chirurgicale classique est posée . Le principe de l'intervention est similaire à la chirurgie standard , et consisteen une extraction du matériel nucléaire hernié sous-ligamentaire, mais sous anesthésie locale et percutané. Notre expérience confirme que cette procédure estune alternative mini-invasive très efficace dans les positions latérales et foraminales en raison de leur accès direct facile au scanner . Les résultats statistiquesdétaillés seront exposés. Conclusion: La herniectomie sous guidage scanner est une intervention tres efficace dans les conflits disco -radiculaires en particulier foraminaux. Elle est devenu en moinsde 7 ans dans notre institution l'intervention de première intention dans le traitement de la hernie foraminale résistante aux thérapeutiques médicales .

Relevância:

10.00% 10.00%

Publicador:

Resumo:

"Technical challenges exist with infrastructure that can be addressed by nondestructive evaluation (NDE) methods, such as detecting corrosion damage to reinforcing steel that anchor concrete bridge railings to bridge road decks. Moisture and chloride ions reach the anchors along the cold joint between the rails and deck, causing corrosion that weakens the anchors and ultimately the barriers. The Center for Nondestructive Evaluation at Iowa State University has experience in development of measurement techniques and new sensors using a variety of interrogating energies. This research evaluated feasibility of three technologies — x-ray radiation, ground-penetrating radar (GPR), and magnetic flux leakage (MFL) — for detection and quantification of corrosion of embedded reinforcing steel. Controlled samples containing pristine reinforcing steel with and without epoxy and reinforcing steel with 25 percent and 50 percent section reduction were embedded in concrete at 2.5 in. deep for laboratory evaluation. Two of the techniques, GPR and MFL, were used in a limited field test on the Iowa Highway 210 Bridge over Interstate 35 in Story County. The methods provide useful and complementary information. GPR provides a rapid approach to identify reinforcing steel that has anomalous responses. MFL provides similar detection responses but could be optimized to provide more quantitative correlation to actual condition. Full implementation could use either GPR or MFL methods to identify areas of concern, followed by radiography to give a visual image of the actual condition, providing the final guidance for maintenance actions." The full 103 page report and the 2 page Tech Transfer Summary are included in this link.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

OBJECTIVES: To evaluate the socio-demographic as well as the health and psychiatric profiles of adolescents hospitalised for suicide attempt or overwhelming suicide ideation and to assess repetition of suicide attempt over a period of 18 months. PATIENTS AND METHODS: Between April 2000 and September 2001, all patients aged 16 to 21 years admitted to the University Hospitals of Geneva and Lausanne for suicide attempt or ideation were included in the study. At this time (T0) semi-structured face to face interviews were conducted to identify socio-demographic data, mental health and antecedents regarding suicidal conducts. Current psychiatric status was assessed with the MINI (Mini International Neuropsychiatric Instrument). At T1 and T2, reassessments included psychiatric status (MINI) as well as lifestyles, socio-professional situation and suicidal behaviours. RESULTS: At T0, 269 subjects met the study criteria, among whom 83 subjects (56 girls and 27 boys) left the hospital too quickly to be involved or refused to participate in the study (final sample at T0: 149 girls; 37 boys). The participation rate at T1 and T2 was respectively 66% and 62% of the original sample. The percentage of adolescents meeting the criteria for psychiatric diagnoses (91%) was high: affective disorder (78%); anxiety disorder (64%); substance use disorder (39%); eating disorder (9%); psychotic disorder (11%); antisocial personality (7%) with most subjects (85%) having more than one disorder. Around 90% of the subjects interviewed at T1, and/or T2, had received follow-up care after their hospitalisation, either by a primary care physician or a psychotherapist or both. Two subjects died of violent death and 18% made a further suicide attempt. CONCLUSION: Most adolescents hospitalised for suicidal episodes suffer from psychiatric problems which should be addressed by a careful psychiatric assessment, followed up if needed by a structured after care plan.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The goal of this study was to compare the quantity and purity of DNA extracted from biological tracesusing the QIAsymphony robot with that of the manual QIAamp DNA mini kit currently in use in ourlaboratory. We found that the DNA yield of robot was 1.6-3.5 times lower than that of the manualprotocol. This resulted in a loss of 8% and 29% of the alleles correctly scored when analyzing 1/400 and 1/800 diluted saliva samples, respectively. Specific tests showed that the QIAsymphony was at least 2-16times more efficient at removing PCR inhibitors. The higher purity of the DNA may therefore partlycompensate for the lower DNA yield obtained. No case of cross-contamination was observed amongsamples. After purification with the robot, DNA extracts can be automatically transferred in 96-wellsplates, which is an ideal format for subsequent RT-qPCR quantification and DNA amplification. Lesshands-on time and reduced risk of operational errors represent additional advantages of the robotic platform.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Introduction: Diffuse large B-cell lymphomas (DLBCL) represent a heterogeneous disease with variable clinical outcome. Identifying phenotypic biomarkers of tumor cells on paraffin sections that predict different clinical outcome remain an important goal that may also help to better understand the biology of this lymphoma. Differentiating non-germinal centre B-cell-like (non-GCB) from Germinal Centre B-cell-like (GCB) DLBCL according to Hans algorithm has been considered as an important immunohistochemical biomarker with prognostic value among patients treated with R-CHOP although not reproducibly found by all groups. Gene expression studies have also shown that IgM expression might be used as a surrogate for the GCB and ABC subtypes with a strong preferential expression of IgM in ABC DLBCL subtype. ImmunoFISH index based on the differential expression of MUM-1, FOXP1 by immunohistochemistry and on the BCL6 rearrangement by FISH has been previously reported (C Copie-Bergman, J Clin Oncol. 2009;27:5573-9) as prognostic in an homogeneous series of DLBCL treated with R-CHOP. In addition, oncogenic MYC protein overexpression by immunohistochemistry may represent an easy tool to identify the consequences of MYC deregulation in DLBCL. Our aim was to analyse by immunohistochemistry the prognostic relevance of MYC, IgM, GCB/nonGCB subtype and ImmunoFISH index in a large series of de novo DLBCL treated with Rituximab (R)-chemotherapy (anthracyclin based) included in the 2003 program of the Groupe d'Etude des Lymphomes de l'Adulte (GELA) trials. Methods: The 2003 program included patients with de novo CD20+ DLBCL enrolled in 6 different LNH-03 GELA trials (LNH-03-1B, -B, -3B, 39B, -6B, 7B) stratifying patients according to age and age-adjusted IPI. Tumor samples were analyzed by immunohistochemistry using CD10, BCL6, MUM1, FOXP1 (according to Barrans threshold), MYC, IgM antibodies on tissue microarrays and by FISH using BCL6 split signal DNA probes. Considering evaluable Hans score, 670 patients were included in the study with 237 (35.4%) receiving intensive R-ACVBP regimen and 433 (64.6%) R-CHOP/R-mini-CHOP. Results: 304 (45.4%) DLBCL were classified as GCB and 366 (54.6%) as non-GCB according to Hans algorithm. 337/567 cases (59.4%) were positive for the ImmunoFISH index (i.e. two out of the three markers positive: MUM1 protein positive, FOXP1 protein Variable or Strong, BCL6 rearrangement). Immunofish index was preferentially positive in the non-GCB subtype (81.3%) compared to the GCB subtype (31.2%), (p<0.001). IgM was recorded as positive in tumor cells in 351/637 (52.4%) DLBCL cases with a preferential expression in non-GCB 195 (53.3%) vs GCB subtype 100(32.9%), p<0.001). MYC was positive in 170/577 (29.5%) cases with a 40% cut-off and in 44/577 (14.2%) cases with a cut-off of 70%. There was no preferential expression of MYC among GCB or non-GCB subtype (p>0.4) for both cut-offs. Progression-free Survival (PFS) was significantly worse among patients with high IPI score (p<0.0001), IgM positive tumor (p<0.0001), MYC positive tumor with a 40% threshold (p<0.001), ImmunoFISH positive index (p<0.002), non-GCB DLBCL subtype (p<0.0001). Overall Survival (OS) was also significantly worse among patients with high IPI score (p<0.0001), IgM positive tumor (p=0.02), MYC positive tumor with a 40% threshold (p<0.01), ImmunoFISH positive index (p=0.02), non-GCB DLBCL subtype (p<0.0001). All significant parameters were included in a multivariate analysis using Cox Model and in addition to IPI, only the GCB/non-GCB subtype according to Hans algorithm predicted significantly a worse PFS among non-GCB subgroup (HR 1.9 [1.3-2.8] p=0.002) as well as a worse OS (HR 2.0 [1.3-3.2], p=0.003). This strong prognostic value of non-GCB subtyping was confirmed considering only patients treated with R- CHOP for PFS (HR 2.1 [1.4-3.3], p=0.001) and for OS (HR 2.3 [1.3-3.8], p=0.002). Conclusion: Our study on a large series of patients included in trials confirmed the relevance of immunohistochemistry as a useful tool to identify significant prognostic biomarkers for clinical use. We show here that IgM and MYC might be useful prognostic biomarkers. In addition, we confirmed in this series the prognostic value of the ImmunoFISH index. Above all, we fully validated the strong and independent prognostic value of the Hans algorithm, daily used by the pathologists to subtype DLBCL.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The success of anatomic repair of Bankart lesion diminishes in the presence of a capsule stretching and/or attenuation is reported in a variable percentage of patients with a chronic gleno-humeral instability. We introduce a new arthroscopic stitch, the MIBA stitch, designed with a twofold aim: to improve tissue grip to reduce the risk of soft tissue tear, particularly cutting through capsular-labral tissue, to and address capsule-labral detachment and capsular attenuation using a double loaded suture anchor. This stitch is a combination of horizontal mattress stitch passing through the capsular-labral complex in a "south-to-north" direction and an overlapping single vertical suture passing through the capsule and labrum in a "east-to-west" direction. The mattress stitch is tied before the vertical stitch in order to reinforce the simple vertical stitch, improving grip and contact force between capsular-labral tissue and glenoid bone.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Background and Objectives: (i) to assess the prevalence of PTSD in a psychiatric emergency setting by means of a diagnostic instrument and to compare it with PTSD-prevalence of a clinically evaluated, historical sample; and (ii) to assess psychiatric residents' perception of the systematic use of this diagnostic instrument. Methods: A consecutive sample of patients (N = 403) evaluated for a psychiatric emergency was assessed with the module J (PTSD) of the MINI, the historical sample (N = 350), assessed by chart review, consisted of consecutive patients of the same setting evaluated one year prior to the study period. Residents' perceptions were assessed by means of a focus group. Results: While in only 0.57% of the historical sample (N = 350) a diagnosis of PTSD was recorded, 20.3% (N = 64) of the patients assessed with the diagnostic instrument (N = 316) qualified for a diagnosis of PTSD. Higher prevalence rates were observed in refugees and those without legal residency status (50%); patients from countries with a recent history of war (47.1%); those with four (44.4%) or three psychiatric co-morbidities (35.3%); migrants (29.8%) and patients without professional income (25%). Residents felt that the systematic use of the tool was not adequate in the psychiatric emergency setting for various reasons (e.g.: not suitable for a first or single consultation, negative impact on the clinical evaluation). Conclusions: The study confirms that PTSD is underdiagnosed in the psychiatric emergency setting. To improve the situation, targeted screening or educational and institutional strategies are needed.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Partitioning of proteins in cholesterol and sphingolipid enriched plasma membrane microdomains, called lipid rafts, is critical for many signal transduction and protein sorting events. Although raft partitioning of many signaling molecules remains to be determined, glycosylphosphatidyl-inositol (GPI)-anchored proteins possess high affinity for lipid rafts and are currently exploited as markers to investigate fundamental mechanisms in protein sorting and signal transduction events. In this study, we demonstrate that two recombinant GPI-anchored green fluorescent proteins (GFP-GPIs) that differ in their GPI signal sequence confer distinct localization in plasma membrane microdomains. GFP fused to the GPI signal of the decay accelerating factor GFP-GPI(DAF) partitioned exclusively in lipid rafts, whereas GFP fused to the GPI signal of TRAIL-R3, GFP-GPI(TRAIL-R3), associated only minimally with microdomains. In addition, we investigated the unique ability of purified GFP-GPIs to insert into membrane microdomains of primary lymphocytes. This cell surface painting allows rapid, stable, and functional association of the GPI-anchored proteins with the target cell plasma membrane. The distinct membrane localization of the two GFP-GPIs was observed irrespective of whether the GPI-anchored molecules were painted or transfected. Furthermore, we show that painted GFP-GPI(DAF) was totally dependent on the GPI anchor and that the membrane insertion was increased by the addition of raft-associated lipids such as cholesterol, sphingomyelin, and dipalmitoyl-phosphatidylethanolamine. Thus, this study provides evidence that different GPI signal sequences lead to distinct membrane microdomain localization and that painted GFP-GPI(DAF) serves as an excellent fluorescent marker for lipid rafts in live cells.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The relevancy of parasites as potential indicators of environmental quality has been increasing over the last years, mostly due to the variety of ways in which they respond to anthropogenic pollution. The use of fish parasites as bioindicators of heavy metal pollution in aquatic ecosystems has been widely studied. However, little information concerning terrestrial habitats is presently available. In fact, in the last two decades several studies have been performed worldwide in different habitats and/or conditions (theoretically both in polluted and unpolluted terrestrialecosystems, but mainly in aquatic ecosystems) in order to investigate heavy metal pollution using parasitological models. Different groups of vertebrates (mainly fish, mammals and birds) and several parasitological models have been tested involving acanthocephalans mostly, but also cestodes and nematodes. It is not the aim of this chapter to do a complete revision of the availabledata concerning this subject. Instead, we emphasize some general aspects and compile a mini-review of the work performed in this field by our research group. The results obtained until now allow confirming several parasitic models as promising bioindicator systems to evaluate environmental cadmium and mainly lead pollution in terrestrial non-urban habitats, as it was already demonstrated for aquatic ecosystems. The present knowledge also allows confirming that parasites can reveal environmental impact. Environmental parasitology is an interdisciplinary field, which needs simultaneous expertise from toxicology, environmental chemistry and parasitology. Furthermore, environmental parasitology should be taken into account in order to increase the efficiency of environmental monitoring programs.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The Swiss postgraduate training program in general internal medicine is now designed as a competency-based curriculum. In other words, by the end of their training, the residents should demonstrate a set of predefined competences. Many of those competences have to be learnt in outpatient settings. Thus, the primary care physicians have more than ever an important role to play in educating tomorrows doctors. A competency-based model of training requires a regular assessment of the residents. The mini-CEX (mini-Clinical Evaluation eXercise) is the assessment tool proposed by the Swiss institute for postgraduate and continuing education. The mini-CEX is based on the direct observation of the trainees performing a specific task, as well as on the ensuing feedback. This article aims at introducing our colleagues in charge of residents to the mini-CEX, which is a useful tool promoting the culture of feedback in medical education.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Introduction : bien que la prévalence des syndromes démentiels soit élevée chez les personnes âgées hospitalisées et qu'une proportion non négligeable échappe au diagnostic, la littérature ne fournit que peu de données chez les patients admis en milieu de réadaptation post-aigu. L'objectif principal de ce travail était de déterminer la prévalence des démences, ainsi que la proportion de démences non diagnostiquées dans une population admise dans un centre de réadaptation gériatrique. Ensuite, nous nous sommes intéressés à identifier les caractéristiques des patients associées à une démence non-détectée. Méthode : nous avons utilisé les données de tous les patients âgés de 70 ans et plus admis durant 3 ans dans l'unité de réadaptation du service de gériatrie et réadaptation gériatrique, Centre Hospitalier Universitaire Vtudois, en excluant les patients décédés pendant l'hospitalisation. Lors de l'admission, des données sociodémographiques, médicales, ainsi que des données concernant le status fonctionnel et mental sont récoltées systématiquement. Par ailleurs, les dossiers des patients ont été examinés pour en extraire les informations quant aux performances cognitive (mini-Mental State Exam, MMSE) et au diagnostic de sortie. Résultats : un diagnostic de démence figurait dans la lettre de sortie de 425 des 1764 patients (24.1%), plus de la moitié présentant une démence de type Alzheimer. Pour 301 de ces 425 patients (70.8%), la démence avait été diagnostiquée durant le séjour de réadaptation. La proportion de démences non-détectées auparavant était plus élevée chez les patients provenant des services de chirurgie/orthopédie que de médecine interne (74.8% vs 65.8%, p=.42). Les patients non diagnostiqués comme déments étaient plus âgés, vivaient plus souvent seuls et avaient de meilleures performances fonctionnelles et cognitives que ceux chez qui le diagnostic avait été posé auparavant. Notamment, un tiers d'entre eux avait un score normal au MMSE. Une analyse multi-variée a mis en évidence deux facteurs prédisposant à la non-détection : l'âge (Odds Ratio (OR) : 2.4 pour le groupe d'âge 85 ans et plus par rapport aux plus jeunes, 96%CI : 1.5-4.0, p=.001) et le score au MMSE (OR : 5.9 lors d'un MMSE normal à l'admission, 96%CI : 2.7-12.7, p<.001) Conclusion et perspectives : cette étude montre qu'environ un quart des patients admis en réadaptation gériatrique souffre de démence, et que cette pathologie n'est pas reconnue chez les trois-quarts d'entre eux. Ces résultats soulignent la nécessité d'un dépistage systématique des troubles cognitifs chez les patients âgés. En effet, en l'absence de détection, ces patients ne peuvent bénéficier d'une prise en charge approprié, incluant non seulement des mesures médicales et pharmacologiques, mais surtout l'information du patient et des proches, dans le but de maintenir une qualité de vie acceptable du patient ainsi que de prévenir l'épuisement des proches et des.soignants. Cette étude incite aussi à être attentif aux signes évocateurs de troubles cognitifs lors de l'interprétation du test MMSE, car un score dans les limites de la norme ne permet pas d'exclure une démence.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The relevancy of parasites as potential indicators of environmental quality has been increasing over the last years, mostly due to the variety of ways in which they respond to anthropogenic pollution. The use of fish parasites as bioindicators of heavy metal pollution in aquatic ecosystems has been widely studied. However, little information concerning terrestrial habitats is presently available. In fact, in the last two decades several studies have been performed worldwide in different habitats and/or conditions (theoretically both in polluted and unpolluted terrestrialecosystems, but mainly in aquatic ecosystems) in order to investigate heavy metal pollution using parasitological models. Different groups of vertebrates (mainly fish, mammals and birds) and several parasitological models have been tested involving acanthocephalans mostly, but also cestodes and nematodes. It is not the aim of this chapter to do a complete revision of the availabledata concerning this subject. Instead, we emphasize some general aspects and compile a mini-review of the work performed in this field by our research group. The results obtained until now allow confirming several parasitic models as promising bioindicator systems to evaluate environmental cadmium and mainly lead pollution in terrestrial non-urban habitats, as it was already demonstrated for aquatic ecosystems. The present knowledge also allows confirming that parasites can reveal environmental impact. Environmental parasitology is an interdisciplinary field, which needs simultaneous expertise from toxicology, environmental chemistry and parasitology. Furthermore, environmental parasitology should be taken into account in order to increase the efficiency of environmental monitoring programs.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

OBJECTIVE: The authors examined the relationship of cognitive impairment at hospital admission to 6-month outcome (hospital readmission, nursing home admission, and death) in a cohort of elderly medical inpatients. METHODS: A group of 401 medical inpatients age 75 and older underwent a comprehensive geriatric assessment at hospital admission and were followed up for 6 months. Cognitive impairment was defined as a score <24 on the Mini-Mental State Exam. Detection was assessed through blinded review of discharge summary. Follow-up data were gathered from the centralized billing system (hospital and nursing home admissions) and from proxies (death). RESULTS: Cognitive impairment was present in 129 patients (32.3%). Only 48 (37.2%) were detected; these had more severe impairment than undetected cases. During follow-up, cognitive impairment, whether detected or not, was associated with death and nursing home admission. After adjustment for health, functional, and socioeconomic status, an independent association remained only for nursing home admission in subjects with detected impairment. Those with undetected impairment appeared to be at intermediate risk, but this relationship was not statistically significant. CONCLUSION: In these elderly medical inpatients, cognitive impairment was frequent, rarely detected, and associated with nursing home admission during follow-up. Although this association was stronger in those with detected impairment, these results support the view that acute hospitalization presents an opportunity to better detect cognitive impairment in elderly patients and target further interventions to prevent adverse outcomes such as nursing home admission.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Brain oxidative processes play a major role in age-related cognitive decline, thus consumption of antioxidant-rich foods might help preserve cognition. Our aim was to assess whether consumption of antioxidant-rich foods in the Mediterranean diet relates to cognitive function in the elderly. In asymptomatic subjects at high cardiovascular risk (n = 447; 52% women; age 5580 y) enrolled in the PREDIMED study, a primary prevention dietary-intervention trial, we assessed food intake and cardiovascular risk profile, determined apolipoprotein E genotype, and used neuropsychological tests to evaluate cognitive function.We also measured urinary polyphenols as an objective biomarker of intake. Associations between energy-adjusted food consumption, urinary polyphenols, and cognitive scores were assessed by multiple linear regression models adjusted for potential confounders. Consumption of some foods was independently related to better cognitive function. The specific associations [regression coefficients (95% confidence intervals)] were: total olive oil with immediate verbal memory [0.755 (0.1511.358)]; virgin olive oil and coffee with delayed verbal memory [0.163 (0.0100.316) and 0.294 (0.0550.534), respectively];walnuts with working memory [1.191 (0.0612.322)]; and wine with Mini-Mental State Examination scores [0.252 (0.0060.496)]. Urinary polyphenols were associated with better scores in immediate verbal memory [1.208 (0.2362.180)]. Increased consumption of antioxidant-rich foods in general and of polyphenols in particular is associated with better cognitive performance in elderly subjects at high cardiovascular risk. The results reinforce the notion that Mediterranean diet components might counteract age-related cognitive decline.