Utility and safety of invasive (fractional flow reserve) and non-invasive (cardiac magnetic resonance imaging) diagnostic tests in patients with NSTEMI

A prospective randomised controlled clinical trial of treatment decisions informed by invasive functional testing of coronary artery disease severity compared with standard angiography-guided management was implemented in 350 patients with a recent non-ST elevation myocardial infarction (NSTEMI) admitted to 6 hospitals in the National Health Service. The main aims of this study were to examine the utility of both invasive fractional flow reserve (FFR) and non-invasive cardiac magnetic resonance imaging (MRI) amongst patients with a recent diagnosis of NSTEMI. In summary, the findings of this thesis are: (1) the use of FFR combined with intravenous adenosine was feasible and safe amongst patients with NSTEMI and has clinical utility; (2) there was discordance between the visual, angiographic estimation of lesion significance and FFR; (3). The use of FFR led to changes in treatment strategy and an increase in prescription of medical therapy in the short term compared with an angiographically guided strategy; (4) in the incidence of major adverse cardiac events (MACE) at 12 months follow up was similar in the two groups. Cardiac MRI was used in a subset of patients enrolled in two hospitals in the West of Scotland. T1 and T2 mapping methods were used to delineate territories of acute myocardial injury. T1 and T2 mapping were superior when compared with conventional T2-weighted dark blood imaging for estimation of the ischaemic area-at-risk (AAR) with less artifact in NSTEMI. There was poor correlation between the angiographic AAR and MRI methods of AAR estimation in patients with NSTEMI. FFR had a high accuracy at predicting inducible perfusion defects demonstrated on stress perfusion MRI. This thesis describes the largest randomized trial published to date specifically looking at the clinical utility of FFR in the NSTEMI population. We have provided evidence of the diagnostic and clinical utility of FFR in this group of patients and provide evidence to inform larger studies. This thesis also describes the largest ever MRI cohort, including with myocardial stress perfusion assessments, specifically looking at the NSTEMI population. We have demonstrated the diagnostic accuracy of FFR to predict reversible ischaemia as referenced to a non-invasive gold standard with MRI. This thesis has also shown the futility of using dark blood oedema imaging amongst all comer NSTEMI patients when compared to novel T1 and T2 mapping methods.

Design, production and testing of innovative key components of HEV/BEV powertrains

Through modelling activity, experimental campaigns, test bench and on-field validation, a complete powertrain for a BEV has been designed, assembled and used in a motorsport competition. The activity can be split in three main subjects, representing the three key components of an BEV vehicle. First of all a model of the entire powertrain has been developed in order to understand how the various design choices will influence the race lap-time. The data obtained was then used to design, build and test a first battery pack. After bench tests and track tests, it was understood that by using all the cell charac-teristics, without breaking the rules limitations, higher energy and power densities could have been achieved. An updated battery pack was then designed, produced and raced with at Motostudent 2018 re-sulting in a third place at debut. The second topic of this PhD was the design of novel inverter topologies. Three inverters have been de-signed, two of them using Gallium Nitride devices, a promising semiconductor technology that can achieve high switching speeds while maintaining low switching losses. High switching frequency is crucial to reduce the DC-Bus capacitor and then increase the power density of 3 phase inverters. The third in-verter uses classic Silicon devices but employs a ZVS (Zero Voltage Switching) topology. Despite the in-creased complexity of both the hardware and the control software, it can offer reduced switching losses by using conventional and established silicon mosfet technology. Finally, the mechanical parts of a three phase permanent magnet motor have been designed with the aim to employ it in UniBo Motorsport’s 2020 Formula Student car.

Novel hydroxystearoyl-, heterocyclic and carbocyclic derivatives: synthesis and applications in biological field

This PhD project has been mainly focused on the synthesis of novel organic compounds containing heterocyclic and/or carbocyclic scaffold and on the study of stearic acid derivatives and their applications in biological field. The synthesis of novel derivatives of 9-hydroxystearic acid (9-HSA) evidenced how the presence of substituents on C9, able to make hydrogen bonds is of crucial importance for the biological activity. Also the position of the hydroxy group along the chain of hydroxystearic acids was investigated: regioisomers with the hydroxy group bound to odd carbons resulted more active than those bearing the hydroxy group on even carbons. Further, the insertion of (R)-9-HSA in magnetic nanoparticles gave a novel material which characterization remarked its suitability for drug delivery. Structural hybrids between amino aza-heterocycles and azelaic acid have been synthesized and some of them showed a selective activity towards osteosarcoma cell line U2OS. Several Apcin analogues bearing indole, benzothiazole, benzofurazan moieties connected to tryptaminyl-, amino pyridinyl-, pyrimidinyl- and pyrazinyl ring through a 1,1,1-trichloroethyl group were synthesized. Biological tests showed the importance of both the tryptaminyl and the pyrimidinyl moieties, confirming the effectiveness against acute leukemia models. The SNAr between 2-aminothiazole derivatives and 7-chlorodinitrobenzofuroxan revealed different behaviour depending from amino substituent of the thiazole. The reaction with 2-N-piperidinyl-, 2-N-morpholinyl-, or 2-N-pyrrolidinyl thiazole gave two isomeric species derived from the attack on C-5 of thiazole ring. Thiazoles substituted with primary- or not-cyclic secondary amines reacted with the exocyclic amino nitrogen atom giving a series of compounds whose biological activity have highlighted as they might be promising candidates for further development of antitumor agents. A series of 9-fluorenylidene derivatives, of interest in medical and optoelectronic field as organic scintillators, was synthesized through Wittig or Suzuky reaction and will be analyzed to test their potential scintillatory properties.

Fabrication and characterization of hybrid ferromagnetic-organic heterostructures for spintronics application

Recent research in the field of organic spintronics highlighted the peculiar spin-dependent properties of the interface formed by an organic semiconductor (OSC) chemisorbed over a 3d ferromagnetic metal, also known as spinterface. The hybridization between the molecular and metallic orbitals, typically π orbitals of the molecule and the d orbitals of the ferromagnet, give rise to spin dependent properties that were not expected by considering the single components of interfaces, as for example the appearance of a magnetic moment on non-magnetic molecules or changes in the magnetic behavior of the ferromagnet. From a technological viewpoint these aspects provide novel engineering schemes for spin memory and for spintronics devices, featuring unexpected interfacial magnetoresistance, spin-filtering effects and even modulated magnetic anisotropy. Applications of these concepts to devices require nevertheless to transfer the spinterface effects from an ideal interface to room temperature operating thin films. In this view, my work presents for the first time how spinterface effects can be obtained even at room temperature on polycrystalline ferromagnetic Co thin films interfaced with organic molecules. The considered molecules were commercial and widely used in the field of organic electronics: Fullerene (C60), Gallium Quinoline (Gaq3) and Sexithiophene (T6). An increase of coercivity, up to 100% at room temperature, has been obtained on the Co ultra-thin films by the deposition of an organic molecule. This effect is accompanied by a change of in-plane anisotropy that is molecule-dependent. Moreover the Spinterface effect is not limited to the interfacial layer, but it extends throughout the whole thickness of the ferromagnetic layer, posing new questions on the nature of the 3d metal-molecule interaction.

Study and characterization of polymorphs of BTBT derivatives and their application in organic electronics

The perquisites of organic semiconductors (OSCs) in the field of organic electronics have attracted much attention due to the advantages like cost-effectiveness, solution processibility, etc. A key property in OSCs is charge carrier mobility, which depends on molecular packing, as even the slightest changes in the packing of OSC can significantly impact the mobility. Organic molecules are constructed by weak interactions, which makes the OSCs prone to adopt multiple packing arrangements, thus giving rise to polymorphism. Therefore, polymorph screening in bulk and thin films is crucial for material development. This thesis aims to present a systematic study of polymorphism of [1]benzothieno[3,2-b]benzothiophene (BTBT) derivatives functionalized with different side chains. The role of peripheral side chains has been studied since they can promote different packing arrangements. The bulk polymorph screening of OSCs was approached with conventional solution mediated recrystallization experiments like evaporation, slurry maturation, anti-solvent precipitation, etc. Each of the polymorphs were inspected for their relative stability and the kinetics of transformation was evaluated. Polymorphism in thin films was also investigated for selected OSCs. Non-equilibrium methods like, thermal gradient and solution shearing were employed to examine the nucleation, crystal growth and morphology in controlled crystallization conditions. After careful analysis of crystal phases in bulk and thin films, OFETs have been fabricated by optimizing the manufacturing conditions and the hole mobility values were extracted. The charge transport property of the OSCs tested for OFETs was supported by the ionization potential and transfer integrals calculation. An attempt to correlate the solid-state structure to electronic properties was carried out. For some of the molecules, mechanical properties have been also investigated, as the response to mechanical stress is highly susceptible to packing arrangements and the intermolecular interaction energy contributions. Additionally, collaborative research was carried out by solving and analysing the crystal structures of six oligorylene molecules.

Philosophy of quantum field theory: an introduction with interviews and comments

In this thesis, I address quantum theories and specifically quantum field theories in their interpretive aspects, with the aim of capturing some of the most controversial and challenging issues, also in relation to possible future developments of physics. To do so, I rely on and review some of the discussions carried on in philosophy of physics, highlighting methodologies and goals. This makes the thesis an introduction to these discussions. Based on these arguments, I built and conducted 7 face-to-face interviews with physics professors and an online survey (which received 88 responses from master's and PhD students and postdoctoral researchers in physics), with the aim of understanding how physicists make sense of concepts related to quantum theories and to find out what they can add to the discussion. Of the data collected, I report a qualitative analysis through three constructed themes.

Yellowing And Bleaching Of Grey Hair Caused By Photo And Thermal Degradation.

Yellowing is an undesirable phenomenon that is common in people with white and grey hair. Because white hair has no melanin, the pigment responsible for hair colour, the effects of photodegradation are more visible in this type of hair. The origin of yellowing and its relation to photodegradation processes are not properly established, and many questions remain open in this field. In this work, the photodegradation of grey hair was investigated as a function of the wavelength of incident radiation, and its ultrastructure was determined, always comparing the results obtained for the white and black fibres present in grey hair with the results of white wool. The results presented herein indicate that the photobehaviour of grey hair irradiated with a mercury lamp or with solar radiation is dependent on the wavelength range of the incident radiation and on the initial shade of yellow in the sample. Two types of grey hair were used: (1) blended grey hair (more yellow) and (2) grey hair from a single-donor (less yellow). After exposure to a full-spectrum mercury lamp for 200 h, the blended white hair turned less yellow (the yellow-blue difference, Db(*) becomes negative, Db(*)=-6), whereas the white hair from the single-donor turned slightly yellower (Db(*)=2). In contrast, VIS+IR irradiation resulted in bleaching in both types of hair, whereas a thermal treatment (at 81 °C) caused yellowing of both types of hair, resulting in a Db(*)=3 for blended white hair and Db(*)=9 for single-donor hair. The identity of the yellow chromophores was investigated by UV-Vis spectroscopy. The results obtained with this technique were contradictory, however, and it was not possible to obtain a simple correlation between the sample shade of yellow and the absorption spectra. In addition, the results are discussed in terms of the morphology differences between the pigmented and non-pigmented parts of grey hair, the yellowing and bleaching effects of grey hair, and the occurrence of dark-follow reactions.

Iis--integrated Interactome System: A Web-based Platform For The Annotation, Analysis And Visualization Of Protein-metabolite-gene-drug Interactions By Integrating A Variety Of Data Sources And Tools.

High-throughput screening of physical, genetic and chemical-genetic interactions brings important perspectives in the Systems Biology field, as the analysis of these interactions provides new insights into protein/gene function, cellular metabolic variations and the validation of therapeutic targets and drug design. However, such analysis depends on a pipeline connecting different tools that can automatically integrate data from diverse sources and result in a more comprehensive dataset that can be properly interpreted. We describe here the Integrated Interactome System (IIS), an integrative platform with a web-based interface for the annotation, analysis and visualization of the interaction profiles of proteins/genes, metabolites and drugs of interest. IIS works in four connected modules: (i) Submission module, which receives raw data derived from Sanger sequencing (e.g. two-hybrid system); (ii) Search module, which enables the user to search for the processed reads to be assembled into contigs/singlets, or for lists of proteins/genes, metabolites and drugs of interest, and add them to the project; (iii) Annotation module, which assigns annotations from several databases for the contigs/singlets or lists of proteins/genes, generating tables with automatic annotation that can be manually curated; and (iv) Interactome module, which maps the contigs/singlets or the uploaded lists to entries in our integrated database, building networks that gather novel identified interactions, protein and metabolite expression/concentration levels, subcellular localization and computed topological metrics, GO biological processes and KEGG pathways enrichment. This module generates a XGMML file that can be imported into Cytoscape or be visualized directly on the web. We have developed IIS by the integration of diverse databases following the need of appropriate tools for a systematic analysis of physical, genetic and chemical-genetic interactions. IIS was validated with yeast two-hybrid, proteomics and metabolomics datasets, but it is also extendable to other datasets. IIS is freely available online at: http://www.lge.ibi.unicamp.br/lnbio/IIS/.

Scaphoid Fracture Nonunion: Correlation Of Radiographic Imaging, Proximal Fragment Histologic Viability Evaluation, And Estimation Of Viability At Surgery: Diagnosis Of Scaphoid Pseudarthrosis.

The purpose of this study was to correlate the pre-operative imaging, vascularity of the proximal pole, and histology of the proximal pole bone of established scaphoid fracture non-union. This was a prospective non-controlled experimental study. Patients were evaluated pre-operatively for necrosis of the proximal scaphoid fragment by radiography, computed tomography (CT) and magnetic resonance imaging (MRI). Vascular status of the proximal scaphoid was determined intra-operatively, demonstrating the presence or absence of puncate bone bleeding. Samples were harvested from the proximal scaphoid fragment and sent for pathological examination. We determined the association between the imaging and intra-operative examination and histological findings. We evaluated 19 male patients diagnosed with scaphoid nonunion. CT evaluation showed no correlation to scaphoid proximal fragment necrosis. MRI showed marked low signal intensity on T1-weighted images that confirmed the histological diagnosis of necrosis in the proximal scaphoid fragment in all patients. Intra-operative assessment showed that 90% of bones had absence of intra-operative puncate bone bleeding, which was confirmed necrosis by microscopic examination. In scaphoid nonunion MRI images with marked low signal intensity on T1-weighted images and the absence of intra-operative puncate bone bleeding are strong indicatives of osteonecrosis of the proximal fragment.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Sensitivity and specificity of machine learning classifiers for glaucoma diagnosis using Spectral Domain OCT and standard automated perimetry

PURPOSE: To evaluate the sensitivity and specificity of machine learning classifiers (MLCs) for glaucoma diagnosis using Spectral Domain OCT (SD-OCT) and standard automated perimetry (SAP). METHODS: Observational cross-sectional study. Sixty two glaucoma patients and 48 healthy individuals were included. All patients underwent a complete ophthalmologic examination, achromatic standard automated perimetry (SAP) and retinal nerve fiber layer (RNFL) imaging with SD-OCT (Cirrus HD-OCT; Carl Zeiss Meditec Inc., Dublin, California). Receiver operating characteristic (ROC) curves were obtained for all SD-OCT parameters and global indices of SAP. Subsequently, the following MLCs were tested using parameters from the SD-OCT and SAP: Bagging (BAG), Naive-Bayes (NB), Multilayer Perceptron (MLP), Radial Basis Function (RBF), Random Forest (RAN), Ensemble Selection (ENS), Classification Tree (CTREE), Ada Boost M1(ADA),Support Vector Machine Linear (SVML) and Support Vector Machine Gaussian (SVMG). Areas under the receiver operating characteristic curves (aROC) obtained for isolated SAP and OCT parameters were compared with MLCs using OCT+SAP data. RESULTS: Combining OCT and SAP data, MLCs' aROCs varied from 0.777(CTREE) to 0.946 (RAN).The best OCT+SAP aROC obtained with RAN (0.946) was significantly larger the best single OCT parameter (p<0.05), but was not significantly different from the aROC obtained with the best single SAP parameter (p=0.19). CONCLUSION: Machine learning classifiers trained on OCT and SAP data can successfully discriminate between healthy and glaucomatous eyes. The combination of OCT and SAP measurements improved the diagnostic accuracy compared with OCT data alone.

Torcidas organizadas e seus jovens torcedores : diversidades e normativas do torcer = Torcidas organizadas and their young supporters : diversities and normatives of supporting

Universidade Estadual de Campinas . Faculdade de Educação Física

Trajetórias de vida : lembranças, caminhos e constituições dos saberes docentes de professores de Educação Física = Paths and trajectories of life : memories, paths and establishment of teaching knowledge of Physical Education Professors

Universidade Estadual de Campinas . Faculdade de Educação Física

Pitfalls of artificial grouping and stratification of scientific journals based on their Impact Factor: a case study in Brazilian Zoology

The present contribution explores the impact of the QUALIS metric system for academic evaluation implemented by CAPES (Coordination for the Development of Personnel in Higher Education) upon Brazilian Zoological research. The QUALIS system is based on the grouping and ranking of scientific journals according to their Impact Factor (IF). We examined two main points implied by this system, namely: 1) its reliability as a guideline for authors; 2) if Zoology possesses the same publication profile as Botany and Oceanography, three fields of knowledge grouped by CAPES under the subarea "BOZ" for purposes of evaluation. Additionally, we tested CAPES' recent suggestion that the area of Ecology would represent a fourth field of research compatible with the former three. Our results indicate that this system of classification is inappropriate as a guideline for publication improvement, with approximately one third of the journals changing their strata between years. We also demonstrate that the citation profile of Zoology is distinct from those of Botany and Oceanography. Finally, we show that Ecology shows an IF that is significantly different from those of Botany, Oceanography, and Zoology, and that grouping these fields together would be particularly detrimental to Zoology. We conclude that the use of only one parameter of analysis for the stratification of journals, i.e., the Impact Factor calculated for a comparatively small number of journals, fails to evaluate with accuracy the pattern of publication present in Zoology, Botany, and Oceanography. While such simplified procedure might appeals to our sense of objectivity, it dismisses any real attempt to evaluate with clarity the merit embedded in at least three very distinct aspects of scientific practice, namely: productivity, quality, and specificity.

The bubbles or the boiling pot?: an ecosystemic approach to culture, environment and quality of life

For the diagnosis and prognosis of the problems of quality of life, a multidisciplinary ecosystemic approach encompasses four dimensions of being-in-the-world, as donors and recipients: intimate, interactive, social and biophysical. Social, cultural and environmental vulnerabilities are understood and dealt with, in different circumstances of space and time, as the conjugated effect of all dimensions of being-in-the-world, as they induce the events (deficits and assets), cope with consequences (desired or undesired) and contribute for change. Instead of fragmented and reduced representations of reality, diagnosis and prognosis of cultural, educational, environmental and health problems considers the connections (assets) and ruptures (deficits) between the different dimensions, providing a planning model to develop and evaluate research, teaching programmes, public policies and field projects. The methodology is participatory, experiential and reflexive; heuristic-hermeneutic processes unveil cultural and epistemic paradigms that orient subject-object relationships; giving people the opportunity to reflect on their own realities, engage in new experiences and find new ways to live better in a better world. The proposal is a creative model for thought and practice, providing many opportunities for discussion, debate and development of holistic projects integrating different scientific domains (social sciences, psychology, education, philosophy, etc.)