Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Extração do óleo essencial de Cymbopogom winterianus J. com CO2 pressurizado

The extraction with pressurized fluids has become an attractive process for the extraction of essential oils, mainly due the specific characteristics of the fluids near the critical region. This work presents results of the extraction process of the essential oil of Cymbopogon winterianus J. with CO2 under high pressures. The effect of the following variables was evaluated: solvent flow rate (from 0.37 to 1.5 g CO2/min), pressure (66.7 and 75 bar) and temperature (8, 10, 15, 20 and 25 ºC) on the extraction kinetics and the total yield of the process, as well as in the solubility and composition of the C. winterianus essential oil. The experimental apparatus consisted of an extractor of fixed bed and the dynamic method was adopted for the calculation of the oil solubility. Extractions were also accomplished by conventional techniques (steam and organic solvent extraction). The determination and identification of extract composition were done by gas chromatography coupled with a mass spectrometer (GC-MS). The extract composition varied in function of the studied operational conditions and also related to the used extraction method. The main components obtained in the CO2 extraction were elemol, geraniol, citronellol and citronellal. For the steam extraction were the citronellal, citronellol and geraniol and for the organic solvent extraction were the azulene and the hexadecane. The most yield values (2.76%) and oil solubility (2.49x10-2 g oil/ g CO2) were obtained through the CO2 extraction in the operational conditions of T = 10°C, P = 66.7 bar and solvent flow rate 0.85 g CO2/min

Aproveitamento de subprodutos da industrialização do escargot

The waste in the industries of escargot processing is very big. This is composed basically of escargot meat out of the commercialization patterns and the visceras. In this context, there is a need to take advantage to the use of these sub-products. A possibility should be drying them and transforming them in a certain form to be reused. Than, the present work has the objective of studying the reutilization of the sub-products of the escargot industrialization for by means of drying process. The samples were transformed in pastes, through a domestic processor for approximately 1 minute and compacted in trays of aluminum without perforations with three different heights (5 mm, 10 mm and 15 mm). The drying was accomplished in a tray dryer with air circulation and transverse flow at a speed of 0,2 m/s and three temperature levels (70°C, 80°C and 90ºC). A drying kinetics study was accomplished for the obtained curves and for the heat and mass transfer coefficients using experimental procedures based in an experimental planning of 22 factorial type. Microbiological and physiochemical analysis were also accomplished for the in nature and the dehydrated sub-products. In the drying process, it was observed the great importance of the external resistances to the mass transfer and heat in the period of constant tax influenced by the temperature. The evaporation taxes indicated a mixed control of the mass transfer for the case of the thickest layers. As already expected, the drying constant behavior was influenced by the temperature and thickness of the medium, increasing and decreasing. The statistical analysis of the results, in agreement with the factorial planning 22, showed that the fissures, the shrinking of the transfer area and the formation of a crust on the surface might have contributed to the differences between the practical results and the linear model proposed. The temperature and the thickness influenced significantly in the answers of the studied variables: evaporation tax and drying constant. They were obtained significant statistical models and predictive ones for evaporation tax for the meat as well as for the visceras

Funcionalidade dos extratos fenólicos obtidos pelo cultivo semi-sólido de resíduos de abacaxi (Ananas comusus L.) e goiaba (Psidium guajava L.)

Solid substrate cultivation (SSC) has become an efficient alternative towards rational use of agro industrial wastes and production of value-added products, mainly in developing countries. This work presents the production and functional application results of phenolic extracts obtained by solid substrate cultivation of pineapple (Ananas comosus L.) and guava (Psidium guajava L.) residues associated to soy flour and bioprocessed by Rhizopus oligosporus fungus. Two experimental groups were tested: (1) 9g of fruit residue and 1g of soy flour (A9 or G9); (2) 5g of fruit residue and 5g of soy flour (A5 or G5). After SSC, 100ml of distilled water was added to each Erlenmeyer flask containing 10g of bioprocessed material in order to obtain the phenolic extracts. Samples were taken every two days for total phenolic concentration (TPC) and antioxidant capacity evaluation by DPPH test during 12-day cultivation. The 2-day and 10-d ay extracts were selected and concentrated by ebullition until 1/10 of original volume was reached. After that, both non-concentrated and concentrated extracts were evaluated for their antimicrobial activity against Staphylococcus aureus and Salmonella enterica and a-amylase inhibitory capacity. It was observed an inverse relationship between total phenolic concentration (TPC) and antioxidant capacity during the cultivation. Besides that, the concentrated pineapple samples after two days were able to inhibit both pathogens tested, especially S. aureus. Guava concentrated extracts after 2 days showed expressive inhibition against S. enterica, but negative results against S. aureus growth. When it comes to a-amylase inhibition, A9 extracts after 2 days, both concentrated or not, completely inhibited enzyme activity. Similar behavior was observed for G9 samples, but only for concentrated samples. It was shown that concentration by ebullition positively affected the enzymatic inhibition of G9 and A9 samples, but on the other side, decreased antiamylase activity of A5 and G5 samples

Avaliação da remoção de sulfeto de hidrogênio do gás natural em uma coluna de absorção

Natural gas, although basically composed by light hydrocarbons, also presents in its composition gaseous contaminants such as CO2 (carbon dioxide) and H2S (hydrogen sulfide). Hydrogen sulfide, which commonly occurs in oil and gas exploration and production activities, besides being among the gases that are responsible by the acid rain and greenhouse effect, can also cause serious harm to health, leading even to death, and damages to oil and natural gas pipelines. Therefore, the removal of hydrogen sulfide will significantly reduce operational costs and will result in oil with best quality to be sent to refinery, thereby resulting in economical, environmental, and social benefits. These factors highlight the need for the development and improvement of hydrogen sulfide sequestrating agents to be used in the oil industry. Nowadays there are several procedures for hydrogen sulfide removal from natural gas used by the petroleum industry. However, they produce derivatives of amines that are harmful to the distillation towers, form insoluble precipitates that cause pipe clogging and produce wastes of high environmental impact. Therefore, the obtaining of a stable system, in inorganic or organic reaction media, that is able to remove hydrogen sulfide without forming by-products that affect the quality and costs of natural gas processing, transport and distribution is of great importance. In this context, the evaluation of the kinetics of H2S removal is a valuable procedure for the treatment of natural gas and disposal of the byproducts generated by the process. This evaluation was made in an absorption column packed with Raschig ring, where natural gas with H2S passes through a stagnant solution, being the contaminant absorbed by it. The content of H2S in natural gas in column output was monitored by an H2S analyzer. The comparison between the obtained curves and the study of the involved reactions have not only allowed to determine the efficiency and mass transfer controlling step of the involved processes but also make possible to effect a more detailed kinetic study and evaluate the commercial potential of each reagent

Análise dos Processos de Flotação e Oxidação Avançada para o Tratamento de Efluente Modelo da Indústria do Petróleo

The generation of wastes in most industrial process is inevitable. In the petroleum industry, one of the greatest problems for the environment is the huge amount of produced water generated in the oil fields. This wastewater is a complex mixture and present great amounts. These effluents can be hazardous to the environmental without adequate treatment. This research is focused in the analysis of the efficiencies of the flotation and photo-oxidation processes to remove and decompose the organic compounds present in the produced water. A series of surfactants derivated from the laurilic alcohol was utilized in the flotation to promote the separation. The experiments have been performed with a synthetic wastewater, carefully prepared with xylene. The experimental data obtained using flotation presented a first order kinetic, identified by the quality of the linear data fitting. The best conditions were found at 0.029 g.L-1 for the surfactant EO 7, 0.05 g.L-1 for EO 8, 0.07 g.L-1 for EO 9, 0.045 g.L-1 for EO 10 and 0.08 g.L-1 for EO 23 with the following estimated kinetic constants: 0.1765, 0.1325, 0.1210, 0.1531 and 0.1699 min-1, respectively. For the series studied, the most suitable surfactant was the EO 7 due to the lower reagent onsumption, higher separation rate constant and higher removal efficiency of xylene in the aqueous phase (98%). Similarly to the flotation, the photo-Fenton process shows to be efficient for degradation of xylene and promoting the mineralization of the organic charge around 90% and 100% in 90 min

Implementação de um modelo computacional para estudo do processo Fischer-Tropsch em reator de leito de lama

This work aims at the implementation and adaptation of a computational model for the study of the Fischer-Tropsch reaction in a slurry bed reactor from synthesis gas (CO+H2) for the selective production of hydrocarbons (CnHm), with emphasis on evaluation of the influence of operating conditions on the distribution of products formed during the reaction.The present model takes into account effects of rigorous phase equilibrium in a reactive flash drum, a detailed kinetic model able of predicting the formation of each chemical species of the reaction system, as well as control loops of the process variables for pressure and level of slurry phase. As a result, a system of Differential Algebraic Equations was solved using the computational code DASSL (Petzold, 1982). The consistent initialization for the problem was based on phase equilibrium formed by the existing components in the reactor. In addition, the index of the system was reduced to 1 by the introduction of control laws that govern the output of the reactor products. The results were compared qualitatively with experimental data collected in the Fischer-Tropsch Synthesis plant installed at Laboratório de Processamento de Gás - CTGÁS-ER-Natal/RN

Estratégias de obtenção do corante do jambo vermelho (Syzygium malaccense) e avaliação de sua funcionalidade

The food industry is interested in natural products. Anthocyanins are phenolic antioxidants of great importance with health-relevant applications. Several studies have linked the intake of fruits and vegetables with reduced risk of chronic degenerative diseases because of its antioxidant properties. This study aimed to compare different strategies for obtaining natural pigments from red jambo (Syzygium malaccence) and analyze its functional potential. Two different strategies were studied: (1) solid-liquid extraction (SLE) in reactor with controlled parameters, (2) powder obtention. The investigation of the functional potential was conducted taking into account the total phenolic content (TPC), the antioxidant activity (AA), the total anthocyanins concentration (TA) and α-amylase and α-glucosidase inhibition. The best extracts obtained by SLE showed TPC of 174.15 mg GAE/100g, AA of 3.56 μmol Trolox eq/g and TA of 133.59 mg cyd-3-glu/100 g. The best results for the second strategy were TPC of 1024.22 mg GAE/100 g, AA of 29.03 μmol Trolox eq/g and TA of 1193.41 mg cyd-3- glu/100 g. It was observed moderate amylase inhibition (26.30%) and high glucosidase inhibitory activity (97.47%). Skin extracts showed, in general, superior results when compared to whole red jambo, with superior values for dehydrated products. Based on our result, red jambo can be considered as a rich source of phenolic antioxidants, as well on amylase and glucosidase inhibitors

Avaliação físico-química e funcional da algaroba prosopis juliflora proveniente da mesorregião agreste do Rio Grande do Norte

Algaroba (Prosopis juliflora) is a typical legume from arid and semi arid regions, which is composed by sugar-rich pods and high protein seeds. Phenolic compounds are secondary metabolites recognized as potent bioactive compounds, found in several vegetables.Therefore, the objective of this work is to characterize the algaroba flour in terms of its physicalchemical composition, total phenolic content, antioxidant activity by DPPH and ABTS methods, a-amylase and a-glycosidase inhibition, as well as to analyze its organic compounds by high performance liquid chromatography (HPLC). Three experimental groups were investigated (seeds, seeds and pod together and only pod), which were prepared by oven drying and posterior grinding. Water and ethanol extracts (70, 80, 100% v/v) were prepared and used for functional studies. Organic compounds were detected by using HPLC equipment coupled to mass spectrometer. Results show important physical-chemical differences among the experimental groups, seeds, seeds and pod together and only pod. The algarroba seed flour is high in protein (49.49%) and fat (3.10%), while the pod flour is especially rich in sugar (60.3% to 67.9%). Algaroba phenolics are concentrated in pod flour, mainly in water extracts (1.30 mg GAEQ/100g sample). All seed extracts showed high DPPH activity and maximum antioxidant activity was registered for ethanol 80% extracts (19.81 μM Trolox/g sample). The ABTS activity ranged from 9.73 to 12.74 μM Trolox/g sample. Nearly all the extracts were able to inhibit α-amylase activity mildly (30.50% to 48.80%), while the maximum α-glycosidase inhibition was observed for pod water extracts (81.03%). Algaroba water extracts proven to be especially rich in organic compounds, observed by the high number of chromatographic peaks. Results demonstrate that algaroba is a potential candidate for further investigations concerning its possible functional applications

Estudo das características físico-químicas e funcionalidade de bagaços de frutas tropicais desidratados em leito de jorro

Fruits are rich sources of bioactive compounds, including phenolic compounds. Tropical fruit cultivation is an important productive segment in Brazilian Northeast. Its industrialization generates solid wastes as co-products, with potential environmental impact. Considering the recognized bioactive content of fruit and its derivatives, this research has the objective of investigating acerola (Malpighia glabra L.), cajá-umbu (Spondia ssp), jambolan (Syzygium cumini) and pitanga (Eugenia uniflora) dried wastes obtained by spouted bed drier. It was analyzed the physical-chemical composition, solubility and microphotographic aspect of these dried wastes. Besides this, it was also evaluated the bioactive content, antioxidant activity and inhibitory activity against aamylase and a-glycosidase enzymes of water and ethanol (70%, 80% e 100% v/v) extracts prepared from fruit dried wastes, as well as their possible correlations. The dried fruit wastes showed high phenolic (606.04 to 3074.6 mg GAE eq/100 g sample), anthocyanin (478.7 mg/100 g for jambolan) and ascorbic acid (2748.03 mg/100 g for acerola) contents, as well as high antioxidant DPPH activity (14.27 a 36.30 mg Trolox eq/g sample). The extracts exhibited moderate to high a-amylase inhibition (23.97% a 76.58%) and high α-glycosidase inhibition, which 99.32% peak was reached for ethanol 70% pitanga extracts. It was also observed great positive correlation between phenolic content and DPPH activity (0.97 for acerola), anthocyanin (0.95 for jambolan) and α- glycosidase inhibition (0.98 for acerola). The α-glycosidase inhibition also correlated well with the antioxidant activity for all fruit extracts. The results show that these dried fruit wastes are valuable material for further applications as functional ingredients

Montagem e operação de um secador pneumático tipo flash

In this work, a pneumatic dryer has been designed and assembled in laboratory scale in order to study and evaluate configurations more efficient for application in drying of important materials of Northeast region in Brazil. The equipment was tested with drying of corn and rice grains, in conditions of temperature and air velocity at 80 oC and 35 m/s, respectively. For this type of dryer, it is recommended to work at temperatures above 200 °C and air velocity with higher dynamic pressure. However, even under operating conditions below what it is recommended, the results obtained with the pneumatic dryer were satisfactory. In addition, experiments of drying were performed by using a cabinet dryer (batch dryer) under the same conditions used in the pneumatic dryer. Flash one curves for the corn were fitted satisfactorily by applying of the Lewis model, while a better agreement was found for rice by using the Page model. The data obtained with both drying processes allowed to compare the performance between pneumatic and batch dryers. In respect to drying rate, the pneumatic dryer presented a similar performance to the batch dryer during processing with corn and a superior performance to the last one during processing with rice. Therefore, it was possible to verify that the pneumatic dryer assembled in this preliminar study can be applied for different materials and under different operating conditions

Avaliacao de dados de secagem de suspensoes de polpas de frutas em leito de jorro com alimentacao intermitente

The objective of this work was the development and improvement of the mathematical models based on mass and heat balances, representing the drying transient process fruit pulp in spouted bed dryer with intermittent feeding. Mass and energy balance for drying, represented by a system of differential equations, were developed in Fortran language and adapted to the condition of intermittent feeding and mass accumulation. Were used the DASSL routine (Differential Algebraic System Solver) for solving the differential equation system and used a heuristic optimization algorithm in parameter estimation, the Particle Swarm algorithm. From the experimental data food drying, the differential models were used to determine the quantity of water and the drying air temperature at the exit of a spouted bed and accumulated mass of powder in the dryer. The models were validated using the experimental data of drying whose operating conditions, air temperature, flow rate and time intermittency, varied within the limits studied. In reviewing the results predicted, it was found that these models represent the experimental data of the kinetics of production and accumulation of powder and humidity and air temperature at the outlet of the dryer

Avaliação da produção de biodiesel de microalga Isochrysis galbana via transesterificação in situ

Microalgae are microscopic photosynthetic organisms that grow rapidly and in different environmental conditions due to their simple cellular structure. The cultivation of microalgae is a biological system capable of storing solar energy through the production of organic compounds via photosynthesis, and these species presents growth faster than land plants, enabling higher biomass yield. Thus, it is understood that the cultivation of these photosynthetic mechanisms is part of a relevant proposal, since, when compared to other oil producing raw materials, they have a significantly higher productivity, thus being a raw material able to complete the current demand by biodiesel . The overall aim of the thesis was to obtain biofuel via transesterification process of bio oil from the microalgae Isochrysis galbana. The specific objective was to estimate the use of a photobioreactor at the laboratory level, for the experiments of microalgae growth; evaluating the characteristics of biodiesel from microalgae produced by in situ transesterification process; studying a new route for disinfection of microalgae cultivation, through the use of the chemical agent sodium hypochlorite. The introduction of this new method allowed obtaining the kinetics of the photobioreactor for cultivation, besides getting the biomass needed for processing and analysis of experiments in obtaining biodiesel. The research showed acceptable results for the characteristics observed in the bio oil obtained, which fell within the standards of ANP Resolution No. 14, dated 11.5.2012 - 18.5.2012. Furthermore, it was demonstrated that the photobioreactor designed meet expectations about study culture growth and has contributed largely to the development of the chosen species of microalgae. Thus, it can be seen that the microalgae Isochrysis galbana showed a species with potential for biodiesel production

Levantamento e avaliação de critérios para a ampliação de escala da produção de biossurfactantes utilizando melaço como substrato

Biosurfactants are amphiphilic molecules synthesized by microorganisms such as bacteria, yeast or filamented fungi cultivated in various carbon sources among sucrose and hydrocarbons. These molecules are composed by a hydrophilic and hydrophobic part. They operate mostly at interfaces of fluids of different polarities. Because of this characteristic, they are potentially employed in numerous industries, such as the textile, medical, cosmetics, food and mainly in the petrochemical ones. Therefore industry has interest in developing new biosurfactant production processes in high scale, in order to become them economically competitive when compared to synthetic biosurfactants. This work aims to evaluate the biosurfactant production applying a non-conventional substrate sugar cane molasses proceeding from the sugar industry thus reducing the production costs. The strain identified as AP029/GLIIA, isolated from oil wells in Rio Grande do Norte state and used in these experiments belongs to the culture collection of Antibiotics Department of UFPE. The fermentation were carried out using different conditions according to a factorial planning 24 with duplicate at center point, in which the studied factors were molasse concentration, nitrate concentration, agitation and aeration ratio. The experiments were performed in a shaker at 38ºC of temperature. Samples were withdrawn in regular periods of time of up to 72 hours of fermentation in order to analyze substrate consumption, cellular concentration, superficial tension, critical micelle dilution (CMD-1 e CMD-2) as well as extracelullar protein production. The results showed a production of 3,480 g/L of biomass, a reduction of 41% on superficial tension, 67% of substrate consumption and 0,2805 g/L of extracellular protein

Desenvolvimento de um secador spray para obtenção de pós finos de precursores de nióbio

This work presents a spray-dryer designed to oxalate-niobate precursors and suitable for the production of Niobium Carbide. The dryer was intended to produce powders of controlled particle size. First, the precursor is dissolved in water to produce a solution of known concentration and then it is atomized on the spray-dryer to produce the powder. This equipment consists of a 304 stainless steel chamber, 0.48 m x 1.9 m (diameter x length), with a conical shape at the lower portion, which is assembled on a vertical platform. The chamber is heated by three 4 kW electrical resistances. In this process, drying air is heated as it flows inside a serpentine surrounding the chamber, in contrary to more traditional processes in which the hot drying air is used to heat the component. The air enters the chamber at the same temperature of the chamber, thus avoiding adherence of particles on the internal surface. The low speed flow is concurrent, directed from the top to the bottom portion of the chamber. Powders are deposited on a 0.4 m diameter tray, which separates the cylindrical portion from the conical portion of the chamber. The humid air is discharged though a plug placed underneath the collecting tray. A factorial experimental planning was prepared to study the influence of five parameters (concentration, input flow, operation temperature, drying air flow and spray air flow) on the characteristics of the powders produced. Particle size distribution and shape were measured by laser granulometry and scanning electronic microscopy. Then, the powders are submitted to reaction in a CH4 / H2 atmosphere to compare the characteristics of spray-dried powders with powders synthetizided by conventional methods