1000 resultados para Antena de banda larga


Relevância:

10.00% 10.00%

Publicador:

Resumo:

Cecropia glaziovii is a tree with used in Brazilian popular medicine. Methods allowing the clonal propagation of this species are of great interest for superior genotype multiplication and perpetuation. For this reason, we examined the effect of different culture media and different types of explants on adventitious shoot regeneration from callus and buds of C. glaziovii. Leaves, petioles and stipules obtained from aseptically grown seedlings or from pre-sterilized plants were used to initiate cultures. Adventitious shoot regeneration was achieved when apical and axillary buds were inoculated on gelled Murashige & Skoog (MS) medium supplemented with 6-benzylaminopurine alone (BAP) (1.0, 5.0 or 10.0 mg L-1) or combined with -naphthalene acetic acid (NAA) (1.0 or 2.0 mg L-1), after 40 days of culture. Best callus production was obtained after 30 days of petioles' culture on gelled MS medium with 2,4 dichlorophenoxyacetic acid (2,4-D) (5.0 mg L-1) combined with BAP (1.0 mg L-1). Successful shoot regeneration from callus was achieved when MS medium supplemented with zeatin (ZEA) (0.1 mg L-1) alone or combined with 2,4-D (1.0 or 5.0 mg L-1) was inoculated with friable callus obtained from petioles. All shoots were rooted by inoculation on MS medium supplemented with indole-3-acetic acid (IAA) (1.0 mg L-1). Rooted plants transferred to potting soil were successfully established. All in vitro regenerated plantlets showed to be normal, without morphological variations, being also identical to the source plant. Our study has shown that C. glaziovii can be propagated by tissue culture methods, allowing large scale multiplication of superior plants for pharmacological purposes.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

É apresentado um estudo sobre sistemas convectivos linearmente organizados e observados por um radar meteorológico banda-C na região semi-árida do Nordeste do Brasil. São analisados três dias (27 a 29) de março de 1985, com ênfase na investigação do papel desempenhado por fatores locais e de grande escala no desenvolvimento dos sistemas. No cenário de grande escala, a área de cobertura do radar foi influenciada por um cavado de ar superior austral no dia 27 e por um vórtice ciclônico de altos níveis no dia 29. A convergência de umidade próxima à superfície favoreceu a atividade convectiva nos dias 27 e 29, enquanto que divergência de umidade próxima à superfície inibiu a atividade convectiva no dia 28. No cenário de mesoescala, foi observado que o aquecimento diurno é um fator importante para a formação de células convectivas, somando-se a ele o papel determinante da orografia na localização dos ecos. De maneira geral, as imagens de radar mostram os sistemas convectivos linearmente organizados em áreas elevadas e núcleos convectivos intensos envolvidos por uma área de precipitação estratiforme. Os resultados indicam que convergência do fluxo de umidade em grande escala e aquecimento radiativo, são fatores determinantes na evolução e desenvolvimento dos ecos na área de estudo.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

An analytical method for the determination of the anti-inflammatory drug 5-aminosalicylic acid (5-ASA) in pharmaceutical formulations using square wave voltammetry at pencil graphite electrodes was developed. After the optimization of the experimental conditions, calibration curves were obtained in the linear concentration range from 9.78 × 10-7 to 7.25 × 10-5 mol L-1 resulting in a limit of detection of 2.12 ± 0.05 x 10-8 mol L-1. Statistical tests showed that the concentrations of 5-ASA in commercial tablets and enemas obtained with the proposed voltammetric method agreed with HPLC values at a 95% confidence level.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

OBJECTIVE: To estimate the spatial intensity of urban violence events using wavelet-based methods and emergency room data. METHODS: Information on victims attended at the emergency room of a public hospital in the city of São Paulo, Southeastern Brazil, from January 1, 2002 to January 11, 2003 were obtained from hospital records. The spatial distribution of 3,540 events was recorded and a uniform random procedure was used to allocate records with incomplete addresses. Point processes and wavelet analysis technique were used to estimate the spatial intensity, defined as the expected number of events by unit area. RESULTS: Of all georeferenced points, 59% were accidents and 40% were assaults. There is a non-homogeneous spatial distribution of the events with high concentration in two districts and three large avenues in the southern area of the city of São Paulo. CONCLUSIONS: Hospital records combined with methodological tools to estimate intensity of events are useful to study urban violence. The wavelet analysis is useful in the computation of the expected number of events and their respective confidence bands for any sub-region and, consequently, in the specification of risk estimates that could be used in decision-making processes for public policies.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The absorption spectra of DPH at fixed concentration do not change with water content in organic solvents. It exhibits monomer bands, such as those obtained in ethanol. The absorption did not change for solutions up to 54 and 46% of water in ethanol and DMSO, respectively, for [DPH] = 5.0 × 10-6 mol L-1 at 30 °C. However, at the same experimental conditions, a gradual sharp decay of the DPH fluorescence is observed. It is proposed that water molecules below these water concentration limits act as quenchers of the excited states of DPH. Stern-Volmer quenching constants by intensities measurements are 7.4 × 10-2 (water/ethanol) and 2.6 × 10-2 L mol-1 (water/DMSO). DPH lifetime measurements in the absence and presence of water resulted in 7.1 × 10-2 L mol-1 in water/ethanol, which pointed out that the process is a dynamic quenching by water molecules. For experiments using DPH as probe, this process can affect data, leading to misunderstanding interpretation.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The aim of this review is to present and discuss the applications of ultrasound in electrochemical systems such as in sonoelectroanalysis and sonoelectrolysis for the electrochemical combustion of organic compounds. Initially, theoretical and experimental aspects are discussed, particularly those related to the enhancement of mass transport and the surface cleaning effects. Some results are included to illustrate alternative geometries for the experimental measurements and the working electrodes used in these systems. In the sequence, the available publications are presented and discussed to demonstrate that ultrasound combined with electrochemical techniques is a powerful set-up for the detection of analytes such as metals and/or organic compounds in hostile media and for the effective destruction of toxic organic substances. At the end, a table summarizes the results already published in the literature.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The potentiality of the use of ultrasound radiation in association with a boron-doped diamond electrode was evaluated on the voltammetric determination of the pesticide carbaryl. Improvements in the sensitivity, limit of detection and reproducibility of the measurements were observed due to both, the enhancement of mass transport and the cleaning of the electrode surface provided by ultrasound. Satisfactory recovery levels for carbaryl in pure water (96-98%) and pineapple juice (89-92%) for quiescent and sonovoltammetric methodologies were obtained. These methodologies can be alternative tools for the analyses of pesticides in fruit samples, mainly the insonated condition that improve the analytical performance and dispense intermediary cleanings of the electrode surface.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Non-coding RNAs (ncRNAs) were recently given much higher attention due to technical advances in sequencing which expanded the characterization of transcriptomes in different organisms. ncRNAs have different lengths (22 nt to >1, 000 nt) and mechanisms of action that essentially comprise a sophisticated gene expression regulation network. Recent publication of schistosome genomes and transcriptomes has increased the description and characterization of a large number of parasite genes. Here we review the number of predicted genes and the coverage of genomic bases in face of the public ESTs dataset available, including a critical appraisal of the evidence and characterization of ncRNAs in schistosomes. We show expression data for ncRNAs in Schistosoma mansoni. We analyze three different microarray experiment datasets: (1) adult worms' large-scale expression measurements; (2) differentially expressed S. mansoni genes regulated by a human cytokine (TNF-α) in a parasite culture; and (3) a stage-specific expression of ncRNAs. All these data point to ncRNAs involved in different biological processes and physiological responses that suggest functionality of these new players in the parasite's biology. Exploring this world is a challenge for the scientists under a new molecular perspective of host-parasite interactions and parasite development.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

An alternative technique for the fabrication of disposable electrochemical microcells containing working, reference and auxiliary electrodes on a single device is reported. The procedure is based on thermal-transfer of toner masks onto CD-R (recordable compact discs) gold surfaces to define the layout of the electrodes (contour). In a subsequent step, the layout is manually painted with a permanent marker pen. The unprotected gold surface is conveniently etched (chemical corrosion) and the ink is then easily removed with ethanol, generating gold surfaces without contamination. The final and reproducible area of the electrodes is defined by heat transference of a second toner mask. Silver epoxy is deposited on one of the gold bands which is the satisfactorily used as reference electrode. These microcells were electrochemically characterized by cyclic, linear, and square wave voltammetry, and several electroactive species were used as model systems. The area reproducibility of the electrodes for different microcells was studied and a relative standard deviation better than 1,0% (n = 10) was obtained. Disposable electrochemical microcells were successfully used in analysis of liquid samples with volumes lower than 200 µL and good stability and reproducibility (RSD less than 2.0%) were achieved. These microcells were also evaluated for quantification of paracetamol and dipyrone in pharmaceutical formulations.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Concrete modules were deployed on the bottom of the 11, 18 and 30 meters isobaths along a cross-shelf hydrographic gradient off Paraná State, Southern Brazil, with the purpose of studying the colonization of sessile epilithic macroinvertebrates on artificial surfaces. After one year of submersion a total of 63 species of epilithic organisms were identified, dominated by Ostrea puelchana, Chthamalus bisinuatus, Balanus cf spongicola, Astrangia cf rathbuni, Didemnum spp, poryphers and bryozoans. Diversity index and percent cover at reef stations placed at 11, 18 and 30 meters isobaths were respectively 2.28 and 66.7%, 2.79 and 96.6% and 1.66 and 77.4%. Differences of general community structure among the three assemblages were not clearly related to the general environmental conditions at the bottom layers near the reef stations. Turbidity and larval abundance are discussed as important factors affecting colonization processes. Results indicate that depths between 15-20 meters are more suitable for the implementation of large scale artificial reef systems in the inner shelf off Paraná and, possibly, throughout the inner shelves off southern Brazil with similar hydrographic conditions.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The circulation and transport of suspended particulate matter in the Caravelas Estuary are assessed. Nearly-synoptic hourly hydrographic, current (ADCP velocity and volume transport) and suspended particulate matter data were collected during a full semidiurnal spring tide, on the two transects Boca do Tomba and Barra Velha and on longitudinal sections at low and high tide. On the first transect the peak ebb currents (-1.5 ms-1) were almost twice as strong as those of the wider and shallow Barra Velha inlet (-0.80 ms-1) and the peak flood currents were 0.75 and 0.60 ms-1, respectively. Due to the strong tidal currents both inlets had weak vertical salinity stratification and were classified with the Stratification-circulation Diagram as Type 2a (partially mixed-weakly stratified) and Type 1a (well mixed). Volume transports were very close, ranging from -3,500 to 3,100 m³s-1 at the ebb and flood, respectively, with a residual -630 m³s-1. The concentration of the suspended particulate matter was closely related to the tidal variation and decreased landwards from 50 mg.L-1 at the estuary mouth, to 10 mg.L-1 at distances of 9 and 16 km for the low and high tide experiments, respectively. The total residual SPM transport was out of the estuary at rates of -18 tons per tidal cycle.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A new species of the formerly monotypic genus Trichogenes is described from a high-altitude stream of the rio Itapemirim system, an isolated Atlantic drainage in the State of Espírito Santo, southeastern Brazil. Trichogenes claviger, new species, differs from all other trichomycterids by the sexually dimorphic posterior process of the opercle, much elongated in males; the terminal mouth; the deeply bifurcated anterior neural spines and the presence of a large anterodorsal claw-like process on the neural arches of the anterior four free vertebrae. The new species also differs from its only congener, T. longipinnis, by a number of additional traits, including the the lack of branched anal-fin rays in specimens of any size; the broader than long posterior nostril; the deeper head (head depth 72.9-86.6% HL); the presence of a fine dark line along the base of the anal fin; the lack of dark spots on cheeks; the shape of the interopercle; the presence of odontodes on a bony expansion on the posterodorsal margin of the interopercle; the fewer vertebrae (35); the absence of an antorbital; and the fewer pleural ribs (eight). Small juveniles of the new species are also strikingly different from those of all other Trichomycteridae, including T. longipinnis, having a very large lateral eye, an upturned mouth, and compressed head. Trichogenes claviger occurs in shaded sectors of a blackwater sluggish stream with sandy substrate and patchy accumulations of vegetable debris, a habitat markedly different from the rocky torrential environment known for T. longipinnis. A comparison of the internal anatomy of the two species provides the basis for a hypothesis of a monophyletic Trichogenes. Data from the new species further support a sister-group relationship between Trichogeninae and Copionodontinae, as well as the position of that clade as sister group to all remaining Trichomycteridae.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A imagem por ressonância magnética (IRM) é o método de diagnóstico por imagem não invasivo mais sensível para avaliar as partes moles, particularmente o encéfalo, porém trata-se de uma técnica onerosa. O método fundamenta-se no fenômeno da ressonância magnética nuclear que ocorre quando núcleos atômicos com propriedades magnéticas presentes no corpo são submetidos a um campo magnético intenso, sendo posteriormente excitados por energia de radiofrequência e gerando, por sua vez, um sinal de onda de radiofrequência capaz de ser captado por uma antena receptora, passando por um processo matemático, chamado Transformada de Fourier, para posterior formação da imagem. Esse estudo objetivou realizar 10 exames completos da cabeça em cadáveres de cães normais à IRM e confeccionar um Atlas com as estruturas identificadas. As imagens foram adquiridas em um aparelho de ressonância magnética Gyroscan S15/HP Philips com campo magnético de 1,5Tesla. Os cadáveres foram posicionados com a cabeça no interior de uma bobina de cabeça humana e foram submetidos a cortes iniciais sagitais a partir de onde se planejou os cortes transversais e dorsais nas sequências de pulso spin-eco T1, T2 e DP. Em T1 utilizou-se TR=400ms e TE=30ms, T2 utilizou-se TR=2000ms e TE=80ms e na DP utilizou-se TR=2000ms e TE=30ms. A espessura do corte foi de 4mm, o número de médias foi igual a 2, a matriz foi de 256x256, o fator foi igual a 1,0 e o campo de visão foi de 14cm. A duração do exame completo da cabeça foi de 74,5minutos. As imagens obtidas com as sequências utilizadas e com a bobina de cabeça humana foram de boa qualidade. Em T1 a gordura tornou-se hiperintensa e o líquido hipointenso. Em T2 a gordura ficou menos hiperintensa e o líquido hiperintenso. A cortical óssea e o ar foram hipointensos em todas as sequências utilizadas devido a baixa densidade de prótons. A sequência DP mostrou o melhor contraste entre a substância branca e cinzenta quando comparada a T2 e a T1. T2 evidenciou o líquido cefalorraquidiano tornando possível a distinção dos sulcos e giros cerebrais. Através do exame de IRM foi possível, pelo contraste, identificar as estruturas ósseas componentes da arquitetura da região, músculos, grandes vasos venosos e arteriais e estruturas do sistema nervoso central, além de elementos do sistema digestório, respiratório e estruturas dos olhos entre outras. Nesse estudo as IRM adquiridas nas sequências T1, DP e T2 foram complementares para o estudo dos aspectos anatômicos da cabeça de cães demonstrando-os com riqueza de detalhes. O tempo requerido para o exame completo da cabeça é compátivel para uso em animais vivos desde que devidamente anestesiados e controlados. Os resultados obtidos por esse trabalho abrem caminho em nosso meio, para o estudo de animais vivos e para o início da investigação de doenças, principalmente as de origem neurológica, visto ser esta técnica excelente para a visibilização do encéfalo.