Alterations in cardiac dihydropyridine receptors and calcium channel function in mdx mice

Duchenne muscular dystrophy (DMD) is a fatal neuromuscular condition affecting approximately one in 3500 live male births resulting from the lack of the myocyte protein dystrophin. The absence of dystrophin in cardiac myocytes is associated with calcium overload which in turn activates calcium-dependent proteolytic enzymes contributing to congestive heart failure, muscle necrosis and fibrosis. To date, the basis for the calcium overload has not been determined. Since L-type calcium channels are a major mediator of calcium influx we determined their potential contribution to the calcium overload. Male muscular dystrophy (mdx) mice and control C57BL10ScSn (C57) mice aged 12– 16 weeks were used in all experiments. In tissue bath studies, isolated contracting left atria from mdx revealed a reduced potency to the dihydropyridine (DHP) agonist BayK8644 and antagonist nifedipine (P < 0.05). Similarly, radioligand binding studies using the DHP antagonist [3H]-PN 200-110 showed a reduced potency (P < 0.05) in isolated membranes, associated with an increased receptor density (P < 0.05). The increased receptor density was supported by RT-PCR experiments revealing increased RNAfor the DHP receptor. Patch clamp studies revealed the presence of a diltiazem sensitive calcium current that showed delayed inactivation in isolated mdx myocytes (P < 0.01). In conclusion, the increased number of DHP binding sites and the delay in L-type current inactivation may both contribute to increased calcium influx and hence calcium overload in the dystrophin deficient mdx cardiac myocytes.

Combined Laser and Intravitreal Triamcinolone for Proliferative Diabetic Retinopathy and Macular Edema: One-year Results of a Randomized Clinical Trial

PURPOSE: To evaluate laser combined with intravitreal triamcinolone acetonide (IVTA) for the management of patients with proliferative diabetic retinopathy (PDR) and clinically significant macular edema (CSME). DESIGN: Randomized clinical trial. METHODS: SETTINGS: Single center. STUDY POPULATION: Twenty-two patients with bilateral treatment,naive moderate PDR and CSME. INTERVENTION: Laser (panretinal and macular) photocoagulation was performed in each eye, followed by IVTA in one randomly assigned eye. Best,corrected visual acuity (BCVA), fundus photography, and optical coherence tomography were performed at baseline and at months 1, 3, 6, 9, and 12. MAIN OUTCOME MEASURES:. Changes in BCVA, central macular thickness (CMT), and total macular volume (TMV). RESULTS: The mean logarithm of the minimal angle of resolution (logMAR) BCVA improved significantly, and mean CMT and TMV were significantly reduced in the IVTA group compared with the laser,only group (controls) at all study follow-up visits (P < .001). The mean logMAR BCVA (Snellen equivalent) was 0.44 (20/50(-2)) for the IVTA group and 0.38 (20/50(+1)) for the controls at baseline, and 0.12 (20/25(-1)) for the IVTA group and 0.32 (20/40(-1)) for the controls at 12 months (P < .001.). The mean CMT and TMV were, respectively, 360 mu m and 8.59 mm(3) for the IVTA group and 331 mu m and 8.44 mm(3) for the controls at baseline, and 236 mu m and 7.32 mm(3) for the IVTA group and 266 mu m and 7.78 mm(3) for the controls at 12 months (P < .001). CONCLUSIONS: The combination of laser photocoagulation with IVTA was associated with improved BCVA and decreased CMT and TMV when compared with laser photocoagulation alone for the treatment of moderate PDR with CSME. (Am J Ophthalmol 2009;147:291-297. (C) 2009 by Elsevier Inc. All rights reserved.)

Ocular toxicity of intravitreous adalimumab (Humira) in the rabbit

Purpose To evaluate the ocular toxicity of escalating doses of intravitreous adalimumab (Humira) in the rabbit eye. Methods Twelve New Zealand albino rabbits received unilateral intravitreous injections of 0.1 ml of adalimumab 0.25 mg (three eyes), 0.50 mg (three eyes), 1.0 mg (three eyes) or 0.1 ml balanced salt solution (BSS, threeeyes). Slit-lamp biomicroscopy and fundoscopy were carried out at baseline, day 1, 7 and 14 following intravitreous injection, while electroretinography (ERG) was carried out at baseline and day 14. Animals were euthanized on day 14, and histopathological examination of the eyes was performed. Results Slit-lamp biomicroscopy and fundoscopy were normal in eyes having received BSS, 0.25 mg or 0.50 mg adalimumab; however, inflammation was present in two of three eyes having received 1.0 mg adalimumab. Similarly, comparison of scotopic and photopic ERG light at baseline and day 14 demonstrated no changes in eyes receiving BSS, 0.25 mg or 0.50 mg adalimumab, but two of three eyes having received 1.0 mg adalimumab showed a greater than 30% reduction in a and b wave. Finally, histopathology demonstrated no differences between eyes receiving BSS, 0.25 mg or 0.50 mg of adalimumab, but two of three eyes injected with 1.0 mg demonstrated inflammatory cell infiltration of the vitreous and anterior chamber, with one of these eyes demonstrating retinal necrosis. Conclusions Escalating doses of intravitreous adalimumab in rabbit eyes caused no detectable functional or structural ocular toxicity up to a dose of 0.50 mg. Administration of 1.0 mg in 0.1 ml was associated with an inflammatory reaction and retinal necrosis.

Repetitive Transcranial Magnetic Stimulation Is Efficacious as an Add-On to Pharmacological Therapy in Complex Regional Pain Syndrome (CRPS) Type I

Single session repetitive transcranial magnetic stimulation (rTMS) of the motor cortex (M1) is effective in the treatment of chronic pain patients but the analgesic effect of repeated sessions is still unknown We evaluated the effects of rTMS in patients with refractory pain due to complex regional pain syndrome (CRPS) type I Twenty three patients presenting CRPS type I of 1 upper limb were treated with the best medical treatment (analgesics and adjuvant medications physical therapy) plus 10 daily sessions of either real (r) or sham (s) 10Hz rTMS to the motor cortex (M1) Patients were assessed daily and after 1 week and 3 months after the last session using the Visual Analogical Scale (VAS) the McGill Pain Questionnaire (MPQ) the Health Survey 36 (SF 36) and the Hamilton Depression (HDRS) During treatment there was a significant reduction in the VAS scores favoring the r rTMS group mean reduction of 4 65 cm (50 9%) against 2 18 cm (24 7%) in the s rTMS group The highest reduction occurred at the tenth session and correlated to improvement in the affective and emotional subscores of the MPQ and SF 36 Real rTMS to the M1 produced analgesic effects and positive changes in affective aspects of pain in CRPS patients during the period of stimulation Perspective This study shows an efficacy of repetitive sessions of high frequency rTMS as an add on therapy to refractory CAPS type I patients It had a positive effect in different aspects of pain (sensory discriminative and emotional affective) It opens the perspective for the clinical use of this technique (C) 2010 by the American Pain Society

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Abnormal Visual Activation in Parkinson`s Disease Patients

Among nonmotor symptoms observed in Parkinson`s disease (PD) dysfunction in the visual system, including hallucinations, has a significant impact in their quality of life. To further explore the visual system in PD patients we designed two fMRI experiments comparing 18 healthy volunteers with 16 PD patients without visual complaints in two visual fMRI paradigms: the flickering checkerboard task and a facial perception paradigm. PD patients displayed a decreased activity in the primary visual cortex (Broadmann area 17) bilaterally as compared to healthy volunteers during flickering checkerboard task and increased activity in fusiform gyms (Broadmann area 37) during facial perception paradigm. Our findings confirm the notion that PD patients show significant changes in the visual cortex system even before the visual symptoms are clinically evident. Further studies are necessary to evaluate the contribution of these abnormalities to the development visual symptoms in PD. (C) 2010 Movement Disorder Society

Inhibition of angiotensin II receptor 1 limits tumor-associated angiogenesis and attenuates growth of murine melanoma

Purpose We evaluated the involvement of angiotensin II (AngII)-dependent pathways in melanoma growth, through the pharmacological blockage of AT1 receptor by the antihypertensive drug losartan (LOS). Results We showed immunolabeling for both AngII and the AT1 receptor within the human melanoma microenvironment. Like human melanomas, we showed that murine melanomas also express the AT1 receptor. Growth of murine melanoma, both locally and at distant sites, was limited in mice treated with LOS. The reduction in tumor growth was accompanied by a twofold decrease in tumorassociated microvessel density and by a decrease in CD31 mRNA levels. While no differences were found in the VEGF expression levels in tumors from treated animals, reduction in the expression of the VEGFR1 (Flt-1) at the mRNA and protein levels was observed. We also showed downregulation of mRNA levels of both Flt-4 and its ligand, VEGF-C. Conclusions Together, these results show that blockage of AT1 receptor signaling may be a promising anti-tumor strategy, interfering with angiogenesis by decreasing the expression of angiogenic factor receptors.

Relationship between use of technology and employment rates for people with physical disabilities in Australia: Implications for education and training programmes

This study examined the impact of computer and assistive device use on the employment status and vocational modes of people with physical disabilities in Australia. A survey was distributed to people over 15 years in age with physical disabilities living in the Brisbane area. Responses were received from 82 people, including those with spinal cord injuries, cerebral palsy and muscular dystrophy. Of respondents 46 were employed, 22 were unemployed, and 12 were either students or undertaking voluntary work. Three-quarters of respondents used a computer in their occupations, while 15 used assistive devices. Using logistic regression analysis it was found that gender, education, level of computer skill and computer training were significant predictors of employment outcomes. Neither the age of respondent nor use of assistive software were significant predictors. From information obtained in this study guidelines for a training programme designed to maximize the employability of people with physical disabilities were developed.

MHC class I and II expression in juvenile dermatomyositis skeletal muscle

Objective To assess MHC I and II expressions in muscle fibres of juvenile dermatomyositis (JDM) and compare with the expression in polymyositis (PM), dermatomyositis (DM) and dystrophy. Patients and methods Forty-eight JDM patients and 17 controls (8 PM, 5 DM and 4 dystrophy) were studied. The mean age at disease onset was 7.1 +/- 3.0 years and the mean duration of weakness before biopsy was 9.4 +/- 12.9 months. Routine histochemistry and immunohistochemistry (StreptABComplex/HRP) for MHC I and II (Dakopatts) were performed on serial frozen muscle sections in all patients. Mann-Whitney, Kruskal Wallis, chi-square and Fisher`s exact statistical methods were used. Results MHC I expression was positive in 47 (97.9%) JDM cases. This expression was observed independent of time of disease corticotherapy previous to muscle biopsy and to the grading of inflammation observed in clinical, laboratorial and histological parameters. The expression of MHC I was similar on JDM, PM and DM, and lower in dystrophy. On the other hand, MHC II expression was positive in just 28.2% of JDM cases was correlated to histological features as inflammatory infiltrate, increased connective tissue and VAS for global degree of abnormality (p < 0.05). MCH II expression was similar in DM/PM and lower in JDM and dystrophy, and it was based on the frequency of positive staining rather than to the degree of the MCH II expression. Conclusions MHC I expression in muscle fibres is a premature and late marker of JDM patient independent to corticotherapy, and MHC II expression was lower in JDM than in PM and DM.

Microangiopathy of the inner ear, deafness, and cochlear implantation in a patient with Susac syndrome

Conclusion: The cochlear implant was beneficial as an attempt to restore hearing and improve communication abilities in this patient with profound sensorineural hearing loss secondary to Susac syndrome. Objective: To report the audiological outcomes of cochlear implantation (CI) in a young woman with Susac syndrome after a 6-month follow-up period. Susac syndrome is a rare disorder. It is clinically characterized by a typical triad of sensorineural deafness, encephalopathy, and visual defect, due to microangiopathy involving the brain, inner ear, and retina. Methods: This was a retrospective review of a case at a tertiary referral center. After diagnosis, the patient was evaluated by a multidisciplinary team and received a cochlear implant in her right ear. Results: The patient achieved 100% open-set sentence recognition in noise conditions and 92% monosyllable and 68% medial consonant recognition in quiet conditions after 6 months of implant use. She reported the use of the telephone 3 months after activation.

Impact of Atypical Retardation Patterns on Detection of Glaucoma Progression using the GDx with Variable Corneal Compensation

PURPOSE: To evaluate the impact of atypical retardation patterns (ARP) on detection of progressive retinal nerve fiber layer (RNFL) loss using scanning laser polarimetry with variable corneal compensation (VCC). DESIGN: Observational cohort study. METHODS: The study included 377 eyes of 221 patients with a median follow-up of 4.0 years. Images were obtained annually with the GDx VCC (Carl Zeiss Med, itec Inc, Dublin, California, USA), along with optic disc stereophotographs and standard automated perimetry (SAP) visual fields. Progression was determined by the Guided Progression Analysis software for SAP and by masked assessment of stereophotographs by expert graders. The typical scan score (TSS) was used to quantify the presence of ARPs on GDx VCC images. Random coefficients models were used to evaluate the relationship between ARP and RNFL thickness measurements over time. RESULTS: Thirty-eight eyes (10%) showed progression over time on visual fields, stereophotographs, or both. Changes in TSS scores from baseline were significantly associated with changes in RNFL thickness measurements in both progressing and nonprogressing eyes. Each I unit increase in TSS score was associated with a 0.19-mu m decrease in RNFL thickness measurement (P < .001) over time. CONCLUSIONS: ARPs had a significant effect on detection of progressive RNFL loss with the GDx VCC. Eyes with large amounts of atypical patterns, great fluctuations on these patterns over time, or both may show changes in measurements that can appear falsely as glaucomatous progression or can mask true changes in the RNFL. (Am J Ophthalmol 2009;148:155-163. (C) 2009 by Elsevier Inc. All rights reserved.)

Comparison of Quantitative Imaging Devices and Subjective Optic Nerve Head Assessment by General Ophthalmologists to Differentiate Normal From Glaucomatous Eyes

Purpose: To compare the ability of Subjective assessment of optic nerve head (ONH) and retinal nerve fiber layer (RNFL) by general ophthalmologists and by a glaucoma expert with objective measurements by optical coherence tomography (Stratus OCT, Carl Zeiss Meditec Inc), confocal scanning laser ophthalmoscope (HRT III; Heidelberg Engineering, Heidelberg. Germany), and scanning laser polarimetry (GDx enhanced corneal compensation; Carl Zeiss Meditec Inc, Dublin, CA) in discriminating glaucomatous and normal eyes. Methods: Sixty-one glaucomatous and 57 normal eyes or 118 subjects Were included in the study. Three independent general ophthalmologists and I glaucoma expert evaluated ONH stereo-photographs. Receiver operating characteristic curves were constructed for each imaging technique and sensitivity at fixed specificity was estimated. Comparisons or areas under these curves (aROCs) and agreement (k) were determined between stereophoto grading and best parameter from each technique. Results: Best parameter from each technique showed larger aROC (Stratus OCT RNFL 0.92; Stratus OCT ONH vertical integrated area = 0.86; Stratus OCT macular thickness = 0.82; GDx enhanced corneal compensation = 0.91, HRT3 global cup-to-disc ratio = 0.83; HRT3 glaucoma probability score numeric area score 0.83) compared with stereophotograph grading by general ophthalmologists (0.80) in separating glaucomatous and normal eyes. Glaucoma expert stereophoto grading provided equal or larger aROC (0.92) than best parameter of each computerized imaging device. Stereophoto evaluated by a glaucoma expert showed better agreement with best parameter of each quantitative imaging technique in classifying eyes either as glaucomatous or normal compared with stereophoto grading by general ophthalmologists, The combination Of Subjective assessment of the optic disc by general ophthalmologists with RNFL objective parameters improved identification of glaucoma patients in a larger proportion than the combination of these objective parameters with Subjective assessment of the optic disc by a glaucoma expert (29.5% vs. 19.7%, respectively). Conclusions: Diagnostic ability of all imaging techniques showed better performance than subjective assessment of the ONH by general ophthalmologists, but not by It glaucoma expert, Objective RNFL measurements may provide improvement in glaucoma detection when combined with subjective assessment of the optic disc by general ophthalmologists or by a glaucoma expert.

Comparison of Fourier-Domain and Time-Domain Optical Coherence Tomography in the Detection of Band Atrophy of the Optic Nerve

PURPOSE: To compare the ability of Fourier-domain (FD) optical coherence tomography (3D OCT-1000; Top, con, Tokyo, Japan) and time domain (TD) OCT (Stratus; Carl Zeiss Meditec Inc, Dublin, California, USA) to detect axonal loss in eyes with band atrophy (BA) of the optic nerve. DESIGN: Cross-sectional study. METHODS: Thirty-six eyes from 36 patients with BA and temporal visual field (VF) defect from chiasmal compression and 36 normal eyes were studied. Subjects were submitted to standard automated perimetry and macular and retinal nerve fiber layer (RNFL) measurements were taken using 3D OCT-1000 and Stratus OCT. Receiver operating characteristic (ROC) curves were calculated for each parameter. Spearman correlation coefficients were obtained to evaluate the relationship between RNFL and macular thickness parameters and severity of VF loss. Measurements from the two devices were compared. RESULTS: Regardless of OCT device, all RNFL and macular thickness parameters were significantly lower in eyes with BA compared with normal eyes, but no statistically significant difference was found with regard to the area under the ROC curve. Structure-function relationships were also similar for the two devices. In both groups, RNFL and macular thickness measurements were generally and in some cases significantly smaller with 3D OCT-1000 than with Stratus OCT. CONCLUSIONS: The introduction of FD technology did not lead to better discrimination ability for detecting BA of the optic nerve compared with TD technology when using the software currently provided by the manufacturer. 3D OCT-1000 FD OCT RNFL and macular measurements were generally smaller than TD Stratus OCT measurements. Investigators should be aware of this fact when comparing measurements obtained with these two devices. (Am J Oplathalmol 2009;147: 56-63. (c) 2009 by Elsevier Inc. All rights reserved.)

Comparison of the GDx VCC scanning laser polarimeter and the stratus optical coherence tomograph in the detection of band atrophy of the optic nerve

Aim To compare the ability of scanning laser polarimeter (SLP) with variable corneal compensation (GDx VCC) and optical coherence tomograph (Stratus OCT) to discriminate between eyes with band atrophy (BA) of the optic nerve and healthy eyes. Methods The study included 37 eyes with BA and temporal visual field (VF) defects from chiasmal compression, and 29 normal eyes. Subjects underwent standard automated perimetry (SAP) and retinal nerve fibre layer (RNFL) scans using GDx VCC and Stratus OCT. The severity of the VF defects was evaluated by the temporal mean defect (TMD), calculated as the average of 22 values of the temporal total deviation plot on SAP. Receiver operating characteristic (ROC) curves were calculated. Pearson`s correlation coefficients were used to evaluate the relationship between RNFL thickness parameters and the TMD. Results No significant difference was found between the ROC curves areas (AUCs) for the GDx VCC and Stratus OCT with regard to average RNFL thickness (0.98 and 0.99, respectively) and the superior (0.94; 0.95), inferior (0.96; 0.97), and nasal (0.92; 0.96) quadrants. However, the AUC in the temporal quadrant (0.77) was significantly smaller (P < 0.001) with GDx VCC than with Stratus OCT (0.98). Lower TMD values were associated with smaller RNFL thickness in most parameters from both equipments. Conclusion Adding VCC resulted in improved performance in SLP when evaluating eyes with BA, and both technologies are sensitive in detecting average, superior, inferior, and nasal quadrant RNFL loss. However, GDx VCC still poorly discriminates RNFL loss in the temporal quadrant when compared with Stratus OCT.