906 resultados para quantitative and qualitative


Relevância:

100.00% 100.00%

Publicador:

Resumo:

This thesis aims at analyzing from the perspective of the manager the importance of the use of quality management tools and concepts in Federal Universities. It was motivated by the following research problem: do Federal University managers consider it to be relevant the quality management in their institution? Therefore, we sought to gather evidence for a satisfactory approach that addresses the complexity of the topic researched: quality, higher education and quality management systems. We chose to adopt an applied study, the exploratory-descriptive research as to the objective and the quantitative and qualitative research as to the approach to the problem. The object of study is composed by the Planning Provosts of Federal Universities listed in the University Ranking Sheet - (RUF) in 2013. We chose to restrict the sample listing only the provosts of the 20 best-placed universities in the ranking of the Federal Universities. The research instrument was composed of 26 questions, of which 6 questions were designed to identify the profile of the manager, 16 questions of perception (manifested variables) on the importance of quality management in the University, where the managers assigned values (answers) to the affirmatives (that address the main topic of this thesis) based on a Likert scale of 5 points, and 4 open and optional questions, in order to identify general management practices used. It was used for statistical analysis (data analysis) descriptive and factorial statistics. The responses collected through the questionnaire portray the managers´ perception regarding the importance of quality management in their institutions. Sixteen variables were addressed, the results of factor analysis of importance were "Important" and "Very Important", where the variable (V2) was "Important" and all others "Very important." With this information, it is possible to prioritize some areas that deserve immediate action. As it was observed that some variables are "Very important" for the vast majority of managers, others did not show the same result as example (V2, V10, V11). It is concluded that the manager´s perception of quality management in his or her institution is relevant, but the same importance is not given to quality programs implemented in other segments of the economy, and that, despite the advancements offered by SINAES, the model does not evaluate the institution in a global way. Thus, with the results, it is expected to contribute to the advancement of the subject, trying to arouse interest from the managers of Federal Universities in the subject, emphasizing the importance of quality management systems as a necessary tool to raise the institutional quality

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Public investments in the development of innovation in the country, either through the rigging of public universities, either through public announcements of the promotion, increased dramatically in recent years. To analyze the efficiency and effectiveness of the use of public resources is especially in times of austerity, essential for the development of a country. In this context, this research aims to identify the influence of public investments to promote innovation in the degree of maturity of innovative companies in the state of the RN. Another goal is to identify the regional influence from the installation site - capital or countryside, in the performance of the companies studied in the degree of innovation. The theoretical basis of the understanding of the scope of the concept of innovation and its determination for the purposes of this study. Typology, degree of innovation, evaluation methodologies and mechanisms to support innovation : Still on the theme of innovation additional concepts that help the reader to a greater understanding, such as are presented. Following is approached conceptualization of the triple helix, highlighting the concepts advocated by Etzkowitz and Leydesdorff, Salomon and Silva and Ipiranga, Freitas and Paiva, among others. With regard to methodological aspects, we propose a descriptive, exploratory and explanatory research quantitative and qualitative approach with the target audience group of companies served by INOVA PRO- NAGI design - multi-institutional action from a public resource called FINEP promotes the development of innovative companies in the State of Rio Grande do Norte - in 2013. The research should provide reflection and understanding of the influence of public investment in innovation, which by means of qualitative predictive variables associated with quantitative method to explain which variables are significant variations in the degree of maturity of enterprises studied

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Este trabalho foi realizado com o objetivo de avaliar as características quantitativas e qualitativas da carcaça e da carne de 24 novilhos submetidos a três estratégias de suplementação em pastagem: SD - suplementação diária; da - suplementação em dias alternados; e FS - suplementação oferecida de segunda à sexta-feira e suspensa aos sábados e domingos. Foram utilizados 24 bovinos mestiços (Bos indicus x Bos taurus) com peso inicial de 230 kg mantidos em pastagem de Brachiaria brizantha cv. Marandu no período das águas de 2003 e nos períodos de seca e das águas de 2004, quando atingiram o peso de abate. O delineamento experimental utilizado foi o inteiramente casualizado, com três tratamentos e oito repetições. As características quantitativas e qualitativas da carcaça e da carne não foram influenciadas pelas diferentes estratégias de suplementação, mesmo quando o suplemento foi fornecido apenas em dias alternados ou quando não foi fornecido nos finais de semana. Na média, os animais apresentaram peso de abate de 468,21 kg de PV, rendimento de carcaça quente de 50,26%, área de olho-de-lombo de 59,67 cm² e espessura de gordura de 3,3 mm. A carne foi classificada como macia, com suculência e palatabilidade levemente acima da média.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

According to the Forest Code of 1965, it is mandatory that every rural property destine part of its land to the establishment of Legal Reserves. When a diagnosis is made over all Brazil, the reality is quite different from what is demanded by law. Therefore, this work, as a general objective, proposes ways of establishing Legal Reserves based on the analysis of the environmental deterioration in a river basin. For this purpose, the environmental deterioration was detected based on three diagnoses: physical-conservational, socioeconomical, and environmental quality. In this way, from a quantitative and qualitative diagnosis, it was possible to identify the main aggressive factors in the studied river basin and to indicate the main vulnerabilities that the area is subjected. According to such diagnosis, some proposals for the establishment of Legal Reserves are discussed here based on scientific arguments aimed at the conservation of water resources, soil and biodiversity. It is hoped, that from this study, the environment receives a new tool for diagnosis, pollution control, recovery and conservation of natural resources.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The competitiveness of the trade generated by the higher availability of products with lower quality and cost promoted a new reality of industrial production with small clearances. Track deviations at the production are not discarded, uncertainties can statistically occur. The world consumer and the Brazilian one are supported by the consumer protection code, in lawsuits against the products poor quality. An automobile is composed of various systems and thousands of constituent parts, increasing the likelihood of failure. The dynamic and security systems are critical in relation to the consequences of possible failures. The investigation of the failure gives us the possibility of learning and contributing to various improvements. Our main purpose in this work is to develop a systematic, specific methodology by investigating the root cause of the flaw occurred on an axle end of the front suspension of an automobile, and to perform comparative data analyses between the fractured part and the project information. Our research was based on a flaw generated in an automotive suspension system involved in a mechanical judicial cause, resulting in property and personal damages. In the investigations concerning the analysis of mechanical flaws, knowledge on materials engineering plays a crucial role in the process, since it enables applying techniques for characterizing materials, relating the technical attributes required from a respective part with its structure of manufacturing material, thus providing a greater scientific contribution to the work. The specific methodology developed follows its own flowchart. In the early phase, the data in the records and information on the involved ones were collected. The following laboratory analyses were performed: macrography of the fracture, micrography with SEM (Scanning Electron Microscope) of the initial and final fracture, phase analysis with optical microscopy, Brinell hardness and Vickers microhardness analyses, quantitative and qualitative chemical analysis, by using X-ray fluorescence and optical spectroscopy for carbon analysis, qualitative study on the state of tension was done. Field data were also collected. In the analyses data of the values resulting from the fractured stock parts and the design values were compared. After the investigation, one concluded that: the developed methodology systematized the investigation and enabled crossing data, thus minimizing diagnostic error probability, the morphology of the fracture indicates failure by the fatigue mechanism in a geometrically propitious location, a tension hub, the part was subjected to low tensions by the sectional area of the final fracture, the manufacturing material of the fractured part has low ductility, the component fractured in an earlier moment than the one recommended by the manufacturer, the percentages of C, Si, Mn and Cr of the fractured part present values which differ from the design ones, the hardness value of the superior limit of the fractured part is higher than that of the design, and there is no manufacturing uniformity between stock and fractured part. The work will contribute to optimizing the guidance of the actions in a mechanical engineering judicial expertise

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The nonionic surfactants are composed of substances whose molecules in solution, does not ionize. The solubility of these surfactants in water due to the presence of functional groups that have strong affinity for water. When these surfactants are heated is the formation of two liquid phases, evidenced by the phenomenon of turbidity. This study was aimed to determine the experimental temperature and turbidity nonilfenolpoliethoxyled subsequently perform a thermodynamic modeling, considering the models of Flory-Huggins and the empirical solid-liquid equilibrium (SLE). The method used for determining the turbidity point was the visual method (Inoue et al., 2008). The experimental methodology consisted of preparing synthetic solutions of 0,25%, 0,5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 12,5%, 15%, 17% and 20% by weight of surfactant. The nonionic surfactants used according to their degree of ethoxylation (9.5, 10, 11, 12 and 13). During the experiments the solutions were homogenized and the bath temperature was gradually increased while the turbidity of the solution temperature was checked visually Inoue et al. (2003). These temperature data of turbidity were used to feed the models evaluated and obtain thermodynamic parameters for systems of surfactants nonilfenolpoliethoxyled. Then the models can be used in phase separation processes, facilitating the extraction of organic solvents, therefore serve as quantitative and qualitative parameters. It was observed that the solidliquid equilibrium model (ESL) was best represented the experimental data.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The urban drainage is one of the powers of environmental sanitation and its scope is the quantitative and qualitative aspects. In decision making of managers and the engineering aspects of design are almost always taken into account only the quantitative aspects. However, the waters of the runoff have the highest concentrations of pollutants at the beginning of precipitation. Thus, if the plot pollution removed, the remaining portion can be used for other purposes. This work has aimed to present the variation of water quality of two drainage basins in the city of Natal / RN-Brazil to support the implementation of drainage to consider the qualitative aspect, and identify potential for the use of water. The basins (M and C) are analyzed closed-type, are in the urban area, are predominantly residential occupation and its waters are used for detention ponds and infiltration. The samples were divided into three phases, the first two direct to final points in a basin and the third in traps distributed over the surface drainage. The parameters had been analyzed were pH, conductivity, dissolved oxygen, Color, Turbidity, COD, Ammonia, nitrite, nitrate, total phosphorus, orthophosphate, Sediments solids, total solids, chloride, sulfate, alkalinity, calcium, magnesium, sodium, potassium, Heavy Metals (Chromium, Cadmium, Lead, Zinc and Copper), Eschichia coli and total coliforms. The parameters studied showed high initial pollution load, events and located in different proportions, except nitrite, heavy metals and biological indicators. The size of the surface drainage and topographic its features influence the quality of water. However, the form of sampling is crucial in the qualitative study in the basin. The samplers developed at work, were generated economic and representative results. The urban rainwater presents organic faecal indicators. The runoff of water from both basins shows no risk of salinity and sodicity for use in irrigation, should be noted the content of chloride in the choice of method of irrigation

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Foram estudados, com o auxílio de fotografias aéreas, aspectos qualitativos e quantitativos do relevo e da rede de drenagem de solos de uma área de Santa Bárbara D'Oeste, SP. Esta região compreende 14.625 ha, onde foram selecionadas bacias hidrográficas de 3ª ordem de ramificação e amostras circulares de 5km². As unidades de mapeamento simples ou associações de solos são: Latossolo Vermelho Escuro, Podzólico, Litossolo + Podzólico, Terra Roxa Estruturada + Latossolo Roxo distrófico. Após a caracterização das feições fisiográficas, da área de ocorrência desses solos, foram realizados dois mapas morfopedológicos. No primeiro utilizou-se fotografias aéreas verticais pancromáticas na escala 1: 35.000 (data de 25/6/78) e no segundo imagens orbitais do sensor Thematic Mapper do LANDSAT-5, nas bandas 3, 4 e 5 e composição colorida 3/4/5 na escala 1: 100.000 (data de 12/9/91). As análises qualitativas e quantitativas do relevo (índice de declividade média) e rede de drenagem (densidade de drenagem, freqüência de rios, razão de textura) mostraram-se eficientes na diferenciação das unidades de solo estudadas, tanto em bacias hidrográficas como em amostras circulares. A utilização de fotografias aéreas, permitiu maior riqueza de detalhes na precisão dos limites das unidades de mapeamento e no maior número de unidades de mapeamento discriminadas em relação as imagens orbitais. A composição colorida 3/4/5 permitiu diferenciar os Latossolos argilosos dos Latossolos de textura média, assim como o Latossolo Húmico.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Este artigo, que envolve a combinação de procedimentos quantitativos e qualitativos, traz resultados de pesquisa que analisou o impacto do Fundef na estruturação da rede municipal de ensino de Pirapozinho-SP, e mostra como estes resultados trazem subsídios para um funcionamento mais adequado da atual política de financiamento da educação. Constatou-se que, mesmo sem aumentar os recursos financeiros do ensino fundamental, o Fundef racionalizou e tornou mais eficiente a sua aplicação, diminuindo desvios e desperdícios, e que a instituição dos Conselhos de Acompanhamento e Controle Social possibilitou maior participação popular na fiscalização do executivo aumentando a transparência dos gastos com educação, que a constituição do Fundef abriu a possibilidade de implantação do Fundeb atualmente em vigor e que a melhoria no funcionamento deste está relacionada ao aumento da participação da sociedade nas decisões da política educacional e ao investimento na qualificação desta participação.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

O presente artigo apresenta uma análise do Plano Nacional de Saúde publicado em 2004. Este documento expressa um importante período de transição na gestão do SUS, uma vez que foi predecessor do Pacto pela Saúde. A partir de um estudo descritivo com base em procedimentos quantitativos e qualitativos, o objetivo foi compreender as ideias centrais do documento, identificando as conexões existentes entre seus princípios, objetivos e prioridades. O principal resultado do estudo foi a identificação da integralidade das ações, da capacitação dos recursos humanos e mudança do marco regulatório com base numa visão intersetorial como núcleo central do documento. Essas ideias, por sua vez, circulam pelo discurso das diretrizes do plano, fortalecendo os laços do eixo central do texto na reorganização da atenção ambulatorial e na qualificação profissional. Por fim, quando comparadas metas e ações previstas nas diretrizes, observa-se uma tensão entre o que foram denominados vetores da verticalidade e da horizontalidade, deixando em aberto o rumo do lugar social em disputa.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Introduction: The aging process causes quantitative and qualitative changes in sleeping. Such changes affects more than half of the adults above 65 years old, that live in the community and 70% of the institutionalized, a great negative impact in their quality of life. One of the pathological displays of aging, that share some characteristics with sleeping disorders and predict similar results, is the Frailty Syndrome, that characterize the most weakened and vulnerable elderly. The way sleeping disorders play a role in the frailty pathogeneses remains uncertain. Objective: Evaluate the relation between the sleeping and the frailty syndrome on institutionalized elderly. Methodology: A transversal study was performed with 69 elderly in institutions in the city of João Pessoa PB. Were used the Pittsburgh Sleeping Quality Index and actigraphy to subjective and objective variables, respectively, and questionnaires and specific tests to frailty phenotype variant (Fried Frailty Criteria). In the statistic analysis were used the Pearson correlation test, Chi Square and One-way ANOVA test, with Tukey-Krammer posttest. Subsequently, a Simple Linear Regression model was built. On every statistical analysis were considered a confidence interval of 95% and a p < 0,05. Results: The sample was characterized by the prevalence of the frail (49,3%), women (62,3%), single (50,7%) and 77,52 (±7,82).The frail elderly obtained the worst sleeping quality 10,37 (±4,31) (f = 4,15, p = 0,02), when compared with the non-frail. The sleep latency influenced more the frailty (R2 = 0,13, β standard = 1,76, β = 0,41, p = 0,001). Weren t found differences between the standard resting-activity variable and the frailty phenotype categories. Conclusion: Sleeping alterations, including bad sleeping quality, prolonged sleep latency, low sleep efficiency and day drowsiness, influenced the frailty in institutionalized elderly

Relevância:

100.00% 100.00%

Publicador:

Resumo:

This paperwork attempts to measure the project management maturity in the State Department of Taxation in Rio Grande do Norte. Project management has shown to be a critical component to any organization success, as the projects are directly related to a set of activities resulting into organizational innovations such as products, services and processes; and its improvement is directly aligned with the strategic management. Methodologically, this paperwork uses both a quantitative and qualitative approach that will be applied to the coordinators, sub-coordinators, and directors of the Regional Offices of the State Department of Taxation. In the theoretical reference it is about the public management and analyzes the strategic management in contemporary public administration. Presents the maturity in project management is by discussing the main models: CMM, Capability Maturity Model; PMMM, Project Management Maturity Model; OPM3, Organization Project Maturity Model and the Prado-MMGP, Modelo de Maturidade em Gerenciamento de Projetos. From this analysis, considering attributes as an aid in taking strategic positioning, access to the model, possibility of benchmarking and continuous improvement, the Prado-MMGP model was the most appropriate for this research process. It has been proved that the State Department of Taxation shows a very low project management maturity level. Regarding the acceptance of the maturity dimensions by the State Department, it is still in an early developmental stage, as one of the dimensions showed a poor performance while the rest showed a regular one. In contrast with similar organizations, the maturity results have shown to be below the national average. The maturity assessment enables in the institution the implementation of a plan for institutional growth with the creation of sector strategic and project management

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Este estudo teve o objetivo de avaliar o comportamento de treze tipos de meios filtrantes primários desenvolvidos para uso na filtração a vácuo de lodo de caldo de cana, simulando as operações de formação e desidratação da torta em filtros contínuos de tambor rotativo a vácuo, empregados nas indústrias de açúcar e álcool do Brasil. Para tanto, foi desenvolvida uma planta-piloto anexa ao filtro de tambor rotativo a vácuo, na qual foram realizados todos os ensaios, com o objetivo de refletir a realidade das variáveis operacionais durante uma safra sucroalcooleira. Os resultados são apresentados, comparando-se as taxas de filtração, variando a pressão de formação da torta, temperatura e concentração de auxiliar filtrante, mostrando ao usuário um novo caminho para o melhoramento quantitativo e qualitativo, sem aumentar a área nominal da unidade de filtração.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The public dental services in Brazil were limited, practically, to the basic care, so that the specialized services acted, up to 2002, no more than 3,5% of the total of clinical procedures. That lower offer reveals the difficulty of continuity of the attention, that is, the comprehensiveness in the assistance, particulary, the reference and counter-reference system. Brasil Sorridente search to supply those needs when proposing Speciality Dental's Centers(CEOs Centros de Especialidades Odontológicas, Brazil) to compose the services of average complexity. In 2005, Ministry of Health enabled the three CEOs of Natal, located in the North II, East and West Sanitary Districts. This investigation evaluated the implantation of these CEOs, as support of the family health care teams, in the perspective of organization of the services in assistencial nets in Natal/RN. It was a study of evaluation, with qualitative approach and some quantitative data as contribution. Dentists, users and managers were interviewed to identify and to understand their perceptions, relationships and experiences in the daily of the services. The conceptual base that orientated the investigation was the principle of comprehensiveness, in its operational sense of the hierarchization in health attention levels. The collection of data was done with documental research, direct observation and semi-structured interview. The analysis was accomplished by triangulation of the extracted content from the used techniques and sources of interviewed groups depositions, looking for theoretical-conceptual support in specific bibliography. The results pointed aspects that go away from the comprehensiveness like: low resolution of problems in the basic net; little valorization of the space in the health units; traditional models of access to health services, insufficient offer for some specialties, compromising the reference and counter-reference system; practices centered in procedures in the CEO; bureaucratic directions from basic care to the specialized service; disintegrated and disjointed system among levels of attention; disrespect to the municipal protocol. On the other hand, there is an approach of compreensiveness in situations like: increase of the access and covering in the Family Health Strategy (ESF Estratégia Saúde da Família, Brazil); larger approach between professional and user; tendency to the quantitative and qualitative growth of specialized actions; punctual initiatives of relationships among levels; existence of protocol to guide professionals