Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Influência da luminosidade e da camada de cera epicuticular de superfícies de folhas de soja na infecção de Phakopsora pachyrhizi

A ferrugem asiática, causada pelo fungo Phakopsora pachyrhizi, apresenta-se como um dos mais graves problemas fitossanitários da cultura da soja no Brasil, principalmente por não existirem, até o presente momento, cultivares com níveis de resistência satisfatórios. Objetivou-se estudar a influência da luminosidade e da camada de cera das superfícies foliares na infecção de folhas de soja por P. pachyrhizi. A superfície adaxial ou abaxial de folíolos do primeiro trifólio de plantas da cultivar BRS 154, estádio fenológico V2, foi inoculada com suspensão de 10(5) urediniósporos/mL-1. As plantas foram mantidas por 24 horas em câmara úmida e temperatura de 23ºC, sob luz ou escuro, em delineamento fatorial. Posteriormente, permaneceram 14 dias em fotoperíodo de 12 horas, sendo em seguida avaliada a densidade de lesões e a severidade da doença. Em um segundo experimento, avaliou-se in vitro , no escuro e na luz, a porcentagem de germinação de urediniósporos e de formação de apressórios. As camadas de cera adaxial e abaxial dos folíolos foram analisadas quantitativamente (extrações com clorofórmio) e estruturalmente (microscopia eletrônica de varredura). A densidade de lesões e a severidade foram maiores quando se inoculou a superfície adaxial de plantas incubadas no escuro, sem interação significativa entre os fatores. A germinação dos esporos no escuro (40,7%) foi significativamente superior à germinação na luz (28,5%). O mesmo ocorreu para a formação de apressórios, no escuro (24,7%) e na luz (12,8%). A quantidade e a estrutura das ceras epicuticulares não apresentaram diferenças entre as duas superfícies.

A multi-screening approach for marine-derived fungal metabolites and the isolation of cyclodepsipeptides from Beauveria felina

Extracts obtained from 57 marine-derived fungal strains were analyzed by HPLC-PDA, TLC and ¹H NMR. The analyses showed that the growth conditions affected the chemical profile of crude extracts. Furthermore, the majority of fungal strains which produced either bioactive of chemically distinctive crude extracts have been isolated from sediments or marine algae. The chemical investigation of the antimycobacterial and cytotoxic crude extract obtained from two strains of the fungus Beauveria felina have yielded cyclodepsipeptides related to destruxins. The present approach constitutes a valuable tool for the selection of fungal strains that produce chemically interesting or biologically active secondary metabolites.

Boosting the suppressive effects of Ascaris suum components in IFN-γ-deficient mice

High molecular weight components from Ascaris suum extract suppress ovalbumin-specific immunity in mice. In IFN-γ-deficient mice, ovalbumin-specific delayed-type hypersensitivity reactions are more strongly downregulated by these suppressive components. Here, the cellularity of the delayed-type hypersensitivity reaction in IFN-γ-deficient mice and the increased downregulation induced by Ascaris suum components were analyzed. IL-12p40-dependent neutrophilic influx was predominant. Suboptimal doses of the suppressive fraction from this nematode completely inhibited the hypersensitivity reaction, thus indicating intensification of the immunosuppression under conditions of intense recruitment of IFN-γ-independent neutrophils.

Experimental infections with Paracoccidioides brasiliensis obtained from armadillos: comparison to clinical isolates

Paracoccidioides brasiliensis causes paracoccidioidomycosis (PCM) that is one of the most prevalent systemic human mycoses in Latin America. Armadillos show a high incidence of PCM infection and could, therefore, be a natural reservoir for this fungus. In this study were compared the virulence profiles of isolates obtained from nine-banded armadillos (Dasypus novemcinctus) (PbT1 and PbT4) and isolates from PCM patients (Pb265 and Bt83). Pathogenicity was evaluated by fungal load and analysis of colony morphology. Immunity against the fungus was tested by delayed type hypersensitivity test (DTH) and antibody quantification by ELISA. The higher virulence of PbT1 and PbT4 was suggested by higher fungal load in spleen and lungs. Armadillo isolates and Bt83 presented a cotton-like surface contrasting with the cerebriform appearance of Pb265. All isolates induced cellular and humoral immune responses in infected BALB/c mice. DTH reactions were similarly induced by the four isolates, however, a great variability was observed in specific antibody levels, being the highest ones induced by Bt83 and PbT4. The present work confirms that armadillos harbor P. brasiliensis, whose multiplication and induced immunity in experimentally infected mice are heterogeneous, resembling the behavior of isolates from human PCM. This study reinforces the possibility that armadillos play an important role in the biological cycle of this pathogen.

Bose-Einstein condensation in 87Rb: characterization of the Brazilian experiment

We describe the experimental apparatus and the methods to achieve Bose-Einstein condensation in 87Rb atoms. Atoms are first laser cooled in a standard double magneto-optical trap setup and then transferred into a QUIC trap. The system is brought to quantum degeneracy selectively removing the hottest atoms from the trap by radio-frequency radiation. We also present the main theoretical aspects of the Bose-Einstein condensation phenomena in atomic gases.

Time resolved emission spectroscopy of poly(2,5-dicyano-p-phenylene-vinylene) films

Films of poly (2,5-dicyano-p-phenylene vinylene), DCNPPV, were obtained by electrochemical synthesis over gold thin layer (20 nm) transparent electrode deposited on a glass plate. The DCNPPV films of 4 µm thickness were produced by electropolymerization process of α,α,α',α'-tetrabromo-2-5-dicyano-p-xilene at different applied potentials (-0.15, -0.25, -0.40, -0.60, -0.80, and -1.0 V) using 0.1 mol L-1 of tetraethylammonium bromide in acetonitrile as the supporting electrolyte. The emission decays have three exponential components: a fast component in the picosecond range (200-400 ps), and two other of about one and five nanoseconds at 293 K. The fluorescence quenching process seems to occur by exciton trapping in a low-energy site and quenching by residual bromine monomer attached at the end of the polymer chain. However, the electrochemical synthesis generates entrapped bromide or ion pairs during the growth step of the film which also contributes to the deactivation. The change of the electrolyte from bromide to perchlorate reduces significantly this additional quenching effect by allowing ion exchange of formed bromide with the nonquenching perchloride anion.

Oxidative DNA damage induced by S(IV) in the presence of Cu(II) and Cu(I) complexes

The DNA damage induced by S(IV) in the presence of some Cu(II) complexes in air saturated solution was investigated. The addition of S(IV) to an air saturated solution containing CuII GGA (GGA = glycylglycyl-L-alanine), CuII G3 (G3 = triglycine) or CuII G4 (G4 = tetraglycine) and Ni(II) traces, causes rapid formation of the respective Cu(III) complex, with simultaneous O2 uptake and S(IV) oxidation. SO3•- and HO• were detected by EPR-spin trapping experiments. The DNA strand breaks were attributed to the oxysulfur radicals formed. In the reduction of Cu(II)/BCA (BCA = 4,4' dicarboxy-2-2'-biquinoline) by S(IV), with CuI BCA complex formation, there is the possible formation of carbon centered radical of BCA or peroxyl radical (ROO•) capable of oxidizing DNA bases. The intensity of DNA damage in the presence of these Cu(II) complexes and S(IV) (10-300 µmol L-1) followed the order: CuII BCA ∼ CuII G4 ∼ Cu(II) (added as Cu(NO3)2) > CuII G3 ∼ CuII GGA. Specifically for CuII BCA the damage occurred even at lower S(IV) concentration (0.1 µmol L-1). For the Cu(II) complexes with glycylglycylhistidine, glycylhistidylglycine, glycylhistidyllysine and glycylglycyltyrosylarginine the Cu(III) formation and the DNA damage was not observed.

Larva of Atractocerus Brasiliensis (Lepeletier & Audinet-Serville, 1825) (Lymexylidae, Atractocerinae)

The larva of Atractocerus brasiliensis (Lepeletier & Audinet-Serville, 1825), collected for the first time in Pinus oocarpa Schiede ex Schltdl. (Pinaceae) is described and illustrated. Until now, for Lymexylidae, only the larva of Melittomma sp. (Melittomminae) was known from the neotropical region (Brazil). Biological notes, a comparison with the description of A. brevicornis, the type-species of the genus (recorded from Africa and Madagascar), and history of the known lymexylid larvae are also included.

Heartworm (Dirofilaria immitis) disease in a Brazilian oncilla (Leopardus tigrinus)

Heartworm disease is caused by the intravascular nematode Dirofilaria immitis, a pathogen of public health importance usually associated to domestic dogs and cats, and to a lesser extend to other mammal species. The oncilla (Leopardus tigrinus) is a threatened neotropic felid species that naturally occurs in Brazil. Here, we report the encounter of adult and larval stages of heartworms in a female specimen of L. tigrinus, probable of free-ranging origin, from Ubatuba, São Paulo, Brazil, which died showing clinical signals compatible with heartworm disease. This was the first reported case of D. immitis infection and associated disease in L. tigrinus, also suggesting that the oncilla acted as a definitive host for this parasite. The present findings confirmed D. immitis as a pathogenic agent for this felid species, thus supporting the recommendation for the inclusion of diagnostic testing for this pathogen in routine health screening procedures for captive and free-ranging oncillas in Brazil, especially in those localities where climate conditions support the occurrence of the parasite. Potential reservoirs as oncillas are established beyond the reach of veterinary care, thus representing a continuing risk for domestic animals and humans acquiring heartworm infection. We encourage further serologic and molecular studies aiming to establish D. immitis prevalences in L. tigrinus and other wild carnivores in the region of Ubatuba, as well as ecological and veterinary studies to access the role of this pathogen for the survival of this threatened felid species.

Gene expression profile of the plant pathogen Fusarium graminearum under the antagonistic effect of Pantoea agglomerans

The pathogenic fungus Fusarium graminearum is an ongoing threat to agriculture, causing losses in grain yield and quality in diverse crops. Substantial progress has been made in the identification of genes involved in the suppression of phytopathogens by antagonistic microorganisms; however, limited information regarding responses of plant pathogens to these biocontrol agents is available. Gene expression analysis was used to identify differentially expressed transcripts of the fungal plant pathogen F. graminearum under antagonistic effect of the bacterium Pantoea agglomerans. A macroarray was constructed, using 1014 transcripts from an F. graminearum cDNA library. Probes consisted of the cDNA of F. graminearum grown in the presence and in the absence of P. agglomerans. Twenty-nine genes were either up (19) or down (10) regulated during interaction with the antagonist bacterium. Genes encoding proteins associated with fungal defense and/or virulence or with nutritional and oxidative stress responses were induced. The repressed genes coded for a zinc finger protein associated with cell division, proteins containing cellular signaling domains, respiratory chain proteins, and chaperone-type proteins. These data give molecular and biochemical evidence of response of F. graminearum to an antagonist and could help develop effective biocontrol procedures for pathogenic plant fungi.

Radial variation of anatomical features, wood density and decay resistance in teak (Tectona grandis) from two qualities of growing sites and two climatic regions of Costa Rica

The objective of this study was to show the radial variation of some anatomic characteristics, wood density and natural durability of teak (Tectona grandis L.F.) growing in Costa Rica. Samples of trees 13 years old were obtained from two growing sites (high and low growing) of plantations established in a humid tropical climate (CHT) and dry tropical climate (CST). The variables measured of the fibers as well as for the rays were not affected by the climate or the type of growing site, except for the length of the fibers. The fibers of teak wood from the best growing site were significantly larger. Vessels were found with a greater frequency for the CST but mostly solitary in comparison with the CBT. Average density, maximum density and the variation within the ring presented a light higher magnitude for the CST. The quality of the growing site did not affect these variables. The resistance of fungus attack was similar in the area of heartwood near the pith compared to the heartwood near the sapwood for all the conditions evaluated. Nevertheless, it was observed in some trees a similar resistance of fungus attack for areas of sapwood compared to similar areas of heartwood.

Host status of some selected Brazilian upland rice cultivars to Meloidogyne incognita race 4 and Rotylenchulus reniformis

Nowadays, rice is among the most preferred crops for rotation with soybean and cotton in the large producing areas of Central Brazil. Nevertheless, the host status of the Brazilian upland rice cultivars for Meloidogyne incognita race 4 and Rotylenchulus reniformis has not been investigated and remains unknown. This study dealt with the assessment of the host response of some selected Brazilian upland rice cultivars to these nematodes under glasshouse conditions. The host status for each tested interaction was based on the nematode reproduction factor (RF) and number of nematodes (g root)(-1). Two experiments with M. incognita race 4, referred to as trial I (initial population (IP) = 4000) and trial 2 (IP = 800), included, respectively, 14 cultivars (cvs AN Cirad 141, BRS Monarca, BRS Primavera, AN Cambara, BRS Pepita, BRS Curinga, BRS Sertaneja, IAPAR 9, IAPAR 62, IAPAR 63, IAPAR 64, IAPAR 117, IAC 201, IAC 202) and 19 cultivars (the same ones in Experiment 1 plus cvs BRS Maravilha, BRS Talento, BRS Bonanca, Ricetec Ecco, BRS Soberana). Except for cv. BRS Pepita, rated as resistant, the cultivars were rated as susceptible or moderately susceptible (RF means ranged from 1.09 to 12.56). In a third experiment with R. reniformis (IP = 1800) that included the same cultivars as in Experiment I, all cultivars were rated as resistant (RF means ranged from 0.01 to 0.29).

Pathogenicity and reproductive fitness of Pratylenchus brachyurus on cowpea

The lesion nematode Pratylenchus brachyurus is widespread in cowpea plantations throughout the tropics and sub-tropics. However, the pathogenicity of P. brachyurus on cowpea has been scarcely studied. In this work, it was demonstrated in two glasshouse experiments that an isolate (Pb-20) of P brachyurus was pathogenic to cowpea cv. IPA-206, adversely affecting the plant growth and pod formation and filling. Initial population levels of 5000 and 15 000 nematodes per plant caused reduction of root growth and typical decay of root tissue. The third experiment demonstrated that all six cowpea cultivars selected for evaluation supported reproduction of three isolates of P. brachyurus (Pb-20, Pb-21 and Pb-23) in their roots, although the reproduction factor values obtained indicated that they were dissimilar in their reproductive fitness. Low resistance to R brachyurus was reported for at least one tested cultivar, but apparently of an insufficient degree to be effective for field management of the nematode.

Enzymatic differences between the endophyte Guignardia mangiferae (Botryosphaeriaceae) and the citrus pathogen G. citricarpa

The endophyte Guignardia mangiferae is closely related to G. citricarpa, the causal agent of citrus black spot; for many years these species had been confused with each other. The development of molecular analytical methods has allowed differentiation of the pathogen G. citricarpa from the endophyte G. mangiferae, but the physiological traits associated with pathogenicity were not described. We examined genetic and enzymatic characteristics of Guignardia spp strains; G. citricarpa produces significantly greater amounts of amylases, endoglucanases and pectinases, compared to G. mangiferae, suggesting that these enzymes could be key in the development of citrus black spot. Principal component analysis revealed pectinase production as the main enzymatic characteristic that distinguishes these Guignardia species. We quantified the activities of pectin lyase, pectin methylesterase and endopolygalacturonase; G. citricarpa and G. mangiferae were found to have significantly different pectin lyase and endopolygalacturonase activities. The pathogen G. citricarpa is more effective in pectin degradation. We concluded that there are significant physiological differences between the species G. citricarpa and G. mangiferae that could be associated with differences in pathogenicity for citrus plants.