989 resultados para backend webdevelopment scripting php python javascript nodeJS


Relevância:

10.00% 10.00%

Publicador:

Resumo:

A wild strain of Streptococcus thermophilus isolated from pasteurized milk was evaluated using an experimental model with respect to its adhesion onto stainless steel surfaces and its behaviour when submitted to cleansing and sanification. In milk, the adhesion of the microorganism on to stainless steel surfaces was studied after 6 hours of contact at 45°C with agitation, and after a cleansing process involving cleaning stages with alkaline and acid detergents followed by sanification, in order to evaluate the resistance of the adhered cells. The microorganism adhered to stainless steel surfaces producing a cell load of 10(4) CFU/cm². After alkaline cleansing, no adhered cells were detected but 6 CFU/cm² were still detected on the surfaces after acid cleansing. Cleansing, followed by sanification with sodium hypochlorite, was sufficient to reduce the load of wild S. thermophilus on the stainless steel surfaces to non-detectable levels. The experimental model proved adequate for the study indicating that the wild microorganism S. thermophilus produces biofilms on stainless steel surfaces. Alkaline cleansing remove more that 99.9% of the adhered cells. The few cells adhered on the surface are removed by acid cleansing demonstrating the need to use different steps and types of detergent for efficient cleansing. The best results for the removal of these biofilms are obtained by using alkaline cleansing followed by acid cleaning, this procedure being more efficient when complemented by sanification with sodium hypochlorite.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Easter egg is a popular chocolate-candy in egg form commercialized in Brazil during Easter time. In this research, Quantitative Descriptive Analysis was applied to select sensory attributes which best define the modifications in appearance, aroma, flavor and texture when cocoa butter equivalent (CBE) is added to Easter eggs. Samples with and without CBE were evaluated by a selected panel and fourteen attributes best describing similarities and differences between them, were defined. Terms definition, reference materials and a consensus ballot were developed. After a training period, panelists evaluated the samples in a Complete Block Design using a 9 cm unstructured scale. Principal Component Analysis, ANOVA and Tukey test (p<0.05) were applied to the data in order to select attributes which best discriminated and characterized the samples. Samples showed significant differences (p<0.05) in all attributes. Easter egg without CBE showed higher intensities (p<0.05) in relation to the following descriptors: brown color, characteristic aroma, cocoa mass aroma, cocoa butter aroma, characteristic flavor, cocoa mass flavor, hardness and brittleness.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Polycyclic aromatic hydrocarbons (PAHs) are a group of compounds that have been the subject of much concern due to their toxic potential. In this study, margarine?s, vegetable cream and mayonnaise available on the Brazilian market were analyzed for pyrene, chrysene, benzo(a)pyrene, benzo(b)fluoranthene and dibenzo(a,h)anthracene. The analytical methodology involved liquid-liquid extraction, clean-up on silica gel column and determination by high performance liquid chromatography using fluorescence detector. Variable levels of contamination were found within differents brands of the same product and within differents batches of the same brand. The total PAH content was in the range of 4.1 to 7.1mug/kg in vegetable cream, 1.7 to 3.9mug/kg in margarine and 1.0 to 21.7mug/kg in mayonnaise. In general the products which according to the label contain corn oil showed the highest levels of contamination. Based on these results and on the importance of fat, oils and derived products for the intake of PAHs, it is recommended that producers of margarine, vegetable creams and mayonnaise start to control the contamination of the vegetable oils used in the elaboration of these products, in order to reduce the exposure of consumers to excessive amounts of potentially carcinogenic compounds.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Descriptive terminology and sensory profile of three varieties of brazilian varietal white wines (cultivars Riesling, Gewürztraminer and Chardonnay) were developed by a methodology based on the Quantitative Descriptive Analysis (QDA). The sensory panel consensually defined the sensory descriptors, their respective reference materials and the descriptive evaluation ballot. Ten individuals were selected as judges based on their discrimination, reproducibility and individual consensus with the sensory panel. Twelve descriptors were generated showing similarities and differences among the wine samples. Each descriptor was evaluated using a nine-centimeters non-structured scale with the intensity terms anchored at its ends. The collected data were analysed by ANOVA, Tukey test and Principal Component Analysis (PCA). The results showed a great difference within the sensory profile of Riesling and Gewürztraminer wines, whereas Chardonnay wines showed a lesser variation. PCA separated samples into two groups: a first group formed by wines higher in sweetness and fruitty flavor and aroma; and a second group of wines higher in sourness, adstringency, bitterness, alcoholic and fermented flavors.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The aim of this research was to optimize osmotic dehydration of pineapple, according to two criteria: maximize water loss and minimize solid gain. The process was made as an application to Combined Methods Technology, in which three preservation factors were combined: water activity, pH and chemical preservatives, all being applied at low levels, in order to get a product resembling non-processed fruit. The experiment was divided into three treatments, being: non-coated pineapple pieces (A), pieces coated with alginate (B) and coated with low-methoxyl pectin (C). Process involved the following main steps: enzymatic inactivation of fruit pieces; in treatments B and C, incorporation of their respective coatings; and osmotic dehydration, in sucrose syrup containing potassium sorbate and citric acid. Optimum conditions, determined from Response Surface Methodology, were the following: dehydration of fruit pieces coated by alginate, at 42-47° C, in sucrose syrup at 66-69° Brix, for 220 to 270 minutes. Results indicated that both coatings significantly affected the mass transfers of the process, reducing solid incorporation and increasing water loss; therefore, increasing weight loss and performance ratio (water loss: solid incorporation) took place. Water activity was not significantly affected by the coatings. The product obtained under optimum conditions was submitted to sensorial evaluation, and presented a good general acceptance. Moulds and yeasts countings indicated good microbiological stability of the product for at least 60 days at 30ºC.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

In this article, it is discussed the role of interaction in the process of teaching and learning Portuguese of deaf students at an inclusive school. In the context where the research took place, the hearing teacher does not understand sign language, and there are, in her classroom, hearing students and four deaf students, being three of them sign language users. As the communication between the hearing teacher and the deaf students occurred in different codes - Portuguese and Brazilian sign language - and having a social-interactional approach of language (MOITA LOPES, 1986; FREIRE, 1999), we observed if the interaction among the subjects enabled the deaf students to understand what was being taught. The results showed that the fact of having four deaf students in the same classroom allowed them to work in a cooperative way. Besides, the sign language became more visible in this institution. On the other hand, the interaction between the teacher and her deaf students revealed to be of little significance to the learning process of this small group.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This article aims at discussing the contributions of the Bakhtinian Circle theories to foreign language teaching and learning (HALL et al., 2005), as far as the first years of formal education in Brazil are concerned. Up to the present moment, foreign languages, including English, are not officially part of the National Curriculum of the first five schooling years. Due to the importance of English in a globalized world and despite all the controversial socio-educational impacts of such an influence, there has been an increase in the interest in this discipline at the beginning years of Brazilian public education (ROCHA, 2006), which has been happening at an irregular pace and without official parameters. Therefore, the relevance of this work lies on the possible guidelines it may offer to support a more effective, situated and meaningful teaching-learning process in that context. Standing for a pluralistic approach to language education, we take the bakhtinian speech genres as organizers of the educational process. We strongly believe that through a dialogic, pluralistic and trans/intercultural teaching (MAHER, 2007), whose main objective is the development of multi (COPE e KALANTZIS, 2000) and critical (COMBER, 2006) literacies, the hybridization of genres and cultures, as well as the creation of third spaces (KOSTOGRIZ, 2005; KUMARAVADIVELU, 2008) can happen. From this perspective, foreign language teaching and learning play a transformative role in society and English is seen as a boundary object (STAR e GRIESEMER, 1989), in and by which diversity, pluralism and polyphony can naturally find their way.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This article aims at discussing and articulating views of language under sociocultural, dialogic and discourse perspectives, in order to present a theoretical framework as far as the analysis of textbooks of English as a foreign language for the Brazilian Ensino Fundamental I is concerned. Due to the limited number of studies in this field, to the still considerably structural approach of the English language teaching and learning in our country nowadays and to the important mediation role textbooks play in language education, we believe our work can contribute positively to the construction of critical and multiple literacies, which, in turn, can support an active and transformative educacional process in the present times.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This paper reports some exemplary data related to a research project on the role of translation in foreign language teaching-learning. The data were collected through a questionnaire administered to 47 Brazilian ESL learners. Specifically, the points of the analysis are: how the translation process is conceived by the students; why and when the translation is used by the learners in classroom situations; mother tongue/foreign language relationships in this specific context, among other aspects. The findings reveal that translation, when used a mediating resource for foreign language teaching-learning, can promote target language management.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Prey size is an important factor in food consumption. In studies of feeding ecology, prey items are usually measured individually using calipers or ocular micrometers. Among amphibians and reptiles, there are species that feed on large numbers of small prey items (e.g. ants, termites). This high intake makes it difficult to estimate prey size consumed by these animals. We addressed this problem by developing and evaluating a procedure for subsampling the stomach contents of such predators in order to estimate prey size. Specifically, we developed a protocol based on a bootstrap procedure to obtain a subsample with a precision error of at the most 5%, with a confidence level of at least 95%. This guideline should reduce the sampling effort and facilitate future studies on the feeding habits of amphibians and reptiles, and also provide a means of obtaining precise estimates of prey size.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The behaviour of the albino and melanic variants of Biomphalaria glabrata of Belo Horizonte (MG. Brazil) was studied comparatively, in terms of their respective susceptibilities to infection by Schistosoma mansoni of the same origin, through observation of the elimination of cercariae for a three-month period and the calculation of mortality and infection rates, in control and in infected snails. The number of amoebocytes, granulocytes and hyalinocytes in the circulating hemolymph during different periods of infection was analyzed. The evolution of the infection in the tissues was observed by means of histological cross-sections. The melanic variant showed greater susceptibility to infection and a higher mortality rate. The albino variant showed a higher number of circulating amoebocytes, both granulocytes and hyalinocytes. A higher number of degenerated sporocysts were seen in the histological cross-sections of the albino variant. The results suggest that the melanic variant of B. glabrata was more susceptible to infection by S. mansoni than was the albino variant.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This work investigated the cytotoxic and genotoxic potential of water from the River Paraíba do Sul (Brazil) using Allium cepa roots. An anatomo-morphological parameter (root length), mitotic indices, and frequency of micronuclei were analysed. Eight bulbs were chosen at random for treatment for 24 to 120 hours with the River water collected in the years of 2005 and 2006 from sites in the cities of Tremembé and Aparecida (São Paulo state, Brazil). Daily measurements of the length of the roots grown from each bulb were carried out throughout the experiment. Mitotic index (MI) and frequency of micronuclei (MN) were determined for 2000 cells per root, using 3-5 root tips from other bulbs (7-10). Only in the roots treated with samples of the River water collected in 2005 in Tremembé city was there a decrease in the root length growth compared to the respective control. However, a reduction in MI values was verified for both sites analysed for that year. Considering the data involving root length growth and especially MI values, a cytotoxic potential is suggested for the water of the River Paraíba do Sul at Tremembé and Aparecida, in the year of 2005. On the other hand, since in this year the MN frequency was not affected with the river water treatments, genotoxicity is not assumed for the river water sampled at the aforementioned places.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Food habits of jaguarundi (Puma yagouaroundi) (Geoffroy, 1803) (Carnivora, Felidae) were studied between November 2000 and November 2001, in a 24.9 km² area of secondary Atlantic Rainforest and eucalypt plantation, in the Serra de Paranapiacaba, São Paulo State, Brazil. Analyses of 26 fecal and regurgitate samples, obtained over a stretch of 570.1 km, showed the consumption of 19 prey items and 74 prey occurrences. Small mammals were the most frequent food item (42.5%), followed by birds (21%), reptiles (14%) and medium-sized mammals (3%). The percent occurrence (PO) suggests that the diet consisted mainly of small rodents (30%) and birds (21%). We recorded for the first time the predation of Viperidae snakes by P. yagouaroundi. Although having a large list of items and range of dietary niche breadths (Bsta = 0.76), our data show that jaguarundi prey mainly on small vertebrates (mammals, birds or reptiles), and even in tall tropical forests or eucalypt plantations, it preys mostly on animals that come to, or live on, the ground.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A new species of dactylogyrid monogenean, Apedunculata discoidea gen. n., sp. n. is described and illustrated from the gills of the freshwater fish Prochilodus lineatus (Valenciennes, 1837) in pisciculture ponds from Pirassununga, São Paulo, Brazil. Diagnostic characters of the new genus and species are: 1) vagina dextrolateral slightly sclerotised, opening anteriorly at level of copulatory complex; 2) copulatory organ coiled with two counterclockwise rings; 3) Accessory piece distal and not articulated; 4) body disk-shaped, lacking a peduncle.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.