955 resultados para Inverted sugar
Resumo:
In this work a fast method for the determination of the total sugar levels in samples of raw coffee was developed using the near infrared spectroscopy technique and multivariate regression. The sugar levels were initially obtained using gravimety as the reference method. Later on, the regression models were built from the near infrared spectra of the coffee samples. The original spectra were pre-treated according to the Kubelka-Munk transformation and multiplicative signal correction. The proposed analytical method made possible the direct determination of the total sugar levels in the samples with an error lower by 8% with respect to the conventional methodology.
Resumo:
Isomaltulose, a functional isomer of sucrose, is a non-cariogenic reducing disaccharide; has a low glycemic index; selectively promotes growth of beneficial bifidobacteria in the human intestinal microflora; and has greater stability than sucrose in some foods and beverages. Isomaltulose is a nutritional sugar that is digested more slowly than sucrose, and has health advantages for diabetics and nondiabetics. Immobilization techniques, especially entrapment of the cells, are widely used for conversion of sucrose into isomaltulose. Immobilization offers advantages such as minimum downstream processing, continuous operation and reusability of cells. Isomaltulose is currently considered to be a promising sugar substitute.
Resumo:
Inulin is a functional food ingredient, generally employed as sugar or fat substitute in food systems. This ingredient can be found in several vegetal products, including chicory roots. As the solubility of inulin is susceptible to temperature changes, the product suffers a fractionalization resulting in two phases when cooled, originating a precipitated phase, more viscose, and a liquid phase, of lesser viscosity. The study of rheological properties of different phases of inulin extract is important for equipment designing, such as mixer and bombs. In this work, rheological behavior at three different temperatures (25; 40 and 50 ºC) was determined for liquid and precipitated phases of inulin liquid extract, extracted from chicory roots by hot water diffusion and cooled at two different temperatures (8 and -10 ºC), suffering phases separation. The precipitated phase was analyzed in two conditions: pure and with the addition of microencapsulating agents (maltodextrin and hydrolized starch). All of them presented a linear behavior, similar to that of the Plastics of Bingham. Some of them, however, were not an adequate fit to this model.
Resumo:
In the last few years the sugar-cane mechanical harvested area has increased, especially in regions with appropriated slop. The use of this technology brings some inconveniences, such as, the increase in the percentage of extraneous matter, which causes the reduction of technological quality of the raw material, and losses in the field. Extraneous matter (trash) is composed of tops and leaves in major percentage, plus soil and roots, and eventually some metal parts. In the green cane harvest system the percentage of extraneous matter has a tendency to increase due to the great amount of vegetal matter to be processed. The increase in the blower fan speed to reduce the amount of extraneous matter can lead to an unacceptable economic level of raw material losses. The main objective of this work was, using a cane loss monitor, to evaluate and quantify the amount of visible losses of sugar cane through the primary extractor at two different fan speeds. Afterwards these losses were related to the harvester cleaning efficiency. The piezoelectric transducer shows a reasonable sensibility. The results show that the cleaning efficiency in the primary extractor (85% mean), the cane losses (between 5.68% and 2.15%) and fan speed are interrelated. The total losses and specially splinters (between 3.19% and 0.91%), showed a significant difference among the treatments.
Resumo:
A base-cutter represented for a mechanism of four bars, was developed using the Autocad program. The normal force of reaction of the profile in the contact point was determined through the dynamic analysis. The equations of dynamic balance were based on the laws of Newton-Euler. The linkage was subject to an optimization technique that considered the peak value of soil reaction force as the objective function to be minimized while the link lengths and the spring constant varied through a specified range. The Algorithm of Sequential Quadratic Programming-SQP was implemented of the program computational Matlab. Results were very encouraging; the maximum value of the normal reaction force was reduced from 4,250.33 to 237.13 N, making the floating process much less disturbing to the soil and the sugarcane rate. Later, others variables had been incorporated the mechanism optimized and new otimization process was implemented .
Resumo:
Inulin is a fructooligosacharide found in diverse agricultural products, amongst them garlic, banana, Jerusalem artichoke and chicory root. Inulin generally is used in developed countries, as a substitute of sugar and/or fat due to its characteristics of fitting as functional and dietary food. Chicory root is usually used as source and raw material for commercial extration of inulin. The experiments consisted on drying sliced chicory roots based on a factorial experimental design in a convective dryer whose alows the air to pass perpendicularly through the tray. Effective diffusivity (dependent variable) has been determined for each experimental combination of independent variables (air temperature and velocity). The data curves have been fitted by the solution of the second Fick law and Page's model. Effective difusivity varied from 3.51 x 10-10 m² s-1 to 1.036 x 10-10 m² s-1. It is concluded that, for the range of studied values, air temperature is the only statistically significant variable. So, a first order mathematical model was obtained, representing effective diffusivity behavior as function of air temperature. The best drying condition was correspondent to the trial using the highest drying air temperature.
Resumo:
Civil society and sugarcane farmer demands indicate that harvesting technology has enough limitations to jeopardize production in large sugar cane producing areas. This work analyses the current mechanical harvesting compared to a semi-mechanical harvesting proposal, on the bases of eleven characteristics considered determinant for a quick spreading of green cane harvesting on hilly areas, with lower impact on agricultural labor and farmers investment capacity.
Resumo:
Currently, owing to the occurrence of environmental problems, along with the need of environmental preservation, both the territory management of Hydrographic Basin and the conservation of natural resources have proven to have remarkable importance. Thus, the mean goal of the research is to raise and scrutinize social-economic and technologic data from the Mogi Guaçu River Hydrographic Basin (São Paulo, Brazil). The aim is to group municipalities with similar characteristics regarding the collected data, which may direct joint actions in the Hydrographic Basin Management. There were used both the methods of factorial analysis and automatic hierarchical classifications. Additionally, there is going to be applied a Geographical Information System to represent the outcomes of the methods aforementioned, through the evolvement of a geo-referenced database, which will allow the obtainment of information categorically distributed including theme maps of interest. The main characteristics adopted to group the municipalities were: agricultural area, sugar cane production, small farms, animal production, number of agriculture machinery and equipments and agricultural income. The methodology adopted in the Mogi Guaçu River Hydrographic Basin will be analyzed vis-à-vis its appropriateness on basin management, as well as the possibility of assisting the studies on behalf of the São Paulo Hydrographic Basin groups, to regional development.
Resumo:
In this work the performance of a sugar cane chopped harvester was analysed when fed with two sugar cane mass flows, measuring the invisible losses, which are impossible to measure in the field, harvester sugar cane cleaning efficiency and air velocity on extractors exit. The trial was done under controlled conditions at Copersucar Technology Center in January 2000. The results showed that the flow of sugar cane through the harvester doesn't influence the magnitudes of total invisible losses and raw material cleaning efficiency. The mean air velocity on the primary extractors exit was 12.0 m s-1, and 9.2 m s-1 on the secondary extractor, with a coefficient of variation of 21%, indicating that the poor cleaning performance of the harvester could be related to air velocity difference inside the extractor. Analyzing the data collected in the trials, it was possible to conclude that invisible losses in sugar cane harvester were 10% and the cleaning efficiency was 87%.
Resumo:
One of the problems found in mechanical harvest of sugar cane is the lack of synchronism between the harvest machine and the infield wagon, causing crop losses as well as operational capacity. The objective of the present research was to design a system capable of helping to synchronize the sugar cane harvest machine with the wagon. The communication between tractor and harvest machine is wireless. Two ultrasound sensors coupled to the elevator and a microprocessor manage such information, generating a correct synchronization among the machines. The system was tested in laboratory and on field performing its function adequately, maintaining the two machines in synchronization, indicating and alerting the operators their relative positions. The developed system reduced the sugar cane lost in 60 kg ha-1 comparing to the harvest with the system turned off.
Resumo:
The presence of vegetal impurities in sugarcane delivered to sugarmills as green and dry leaves is a problem not only because they are non-value materials to be processed along with sugarcane stalks, but also because they can rise the color of the clarified juice and, consequently, the color of the sugar produced, with a reduction of its quality for the market. Another problem is the mud volume sedimented in the clarifiers, which also can result in a larger recirculation and greater volume of filtrate juice, with higher losses of sucrose and utilization of the vacuum rotary filters. The objective of this work was to observe the effect of the presence of green and dry leaves on sugarcane juice clarification, related to a control treatment with the addition of fiber extracted from the stalks. The experiments were planned based on the addition of quantities of fibrous sources in order to formulate samples with absolute increase of 0.25 , 0.50 and 0.75 percentual points over the fiber content of the sugarcane stalks (control treatment). The juice clarification was conducted with a laboratory clarifier. The clarified juice color and the mud volume were evaluated. The presence of green leaves caused higher color and mud volume due to the extraction of non-sucrose components of the leaves. Soluble compounds of dry leaves were also extracted, though not detected by juice analysis. The addition of the fiber extracted from the stalks did not induce alterations in the clarification process.
Inibidor da ação do etileno na conservação pós-colheita de Chrysanthemum morifolium Ramat cv. Dragon
Resumo:
The durability and postharvest quality of cut flowers are fundamental attributes in value along the production chain and in consumer satisfaction. The objective of this study was to evaluate the effect of chemical inhibitors of ethylene action on maintaining the postharvest quality of chrysanthemum stems (Chrysanthemum morifolium Ramat cv. Dragon). The experiment tested maintenance solutions with silver thiosulfate (STS) under five levels (distilled water, a 0.2 mM STS, the STS 0.2 mM + sucrose at 50 g L-1, STS at 0.4 mM; STS at 0.4 mM + sucrose at 50 g L-1), and date of sampling, for three levels (0, 3, 6 days). Three replications with two flower stems in each treatment were used in the experiment. Physical assessments were made: color, fresh mass and relative water content; chemical evaluations: reducing sugars and pigments, and qualitative assessments: turgidity, flower color, and number of buds, open flowers and partially open flowers. Treatment with 0.2 mM STS resulted in better maintenance of fresh mass of stems. The concentration of pigments and reducing sugar was higher in those treatments in which sucrose was associated. The color and relative water content were favored in treatments STS 0.2 mM and 0.4 mM. The concentration of 0.2 mM STS obtained the best results, prolonging the vase life the stems. The quality of these stems was higher, with the best assessments of water content, color and turgidity.
Resumo:
The association of 0,03 % v/w pectinase (Clarex), 0,6 % v/w invertase (Invertase-S) and 0,5 % w/w glucose isomerase (Taka-sweet) in industrialized banana (Musa cavendishii) pulp, under conditions of hydrolysis 40oC, 15 minutes, was observed and compared to other three enzymatic treatements: 0,03 % v/w pectinase (Clarex); 0,03 % v/w pectinase (Clarex) associated to 0,6 % v/w invertase (Invertase-S); and 0,03 % v/w pectinase (Sigma) associated to 0,03 % cellulase (Sigma) to determine the quality using a group of physical, physico-chemical, chemical, microbiological and sensory properties of the banana juices obtained. These properties had not differ significantly in function of pectinases and celulase employed. The addition of invertase had increased sweetness and decreased viscosity in juice. On the other side, the addition of glucose isomerase in inverted juice was not able in increasing significantly fructose content.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física