973 resultados para Leukemic cell line


Relevância:

90.00% 90.00%

Publicador:

Resumo:

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Tumour progression is a complex process that frequently brings to cancer metastasis, the first cause of poor prognosis of cancer affected patients. Metastasis are generated by cells escaped from a primary mass and able to enter in the circulation, survive and proliferate in a new, distant site of the organism. To reach all these goal, many different phenomena had occur within both the cancer cells and the surrounding microenvironment. In the first part of this thesis, the focus was pointed on the metastatic potential of a leiomyosarcoma cell model. The studied cancer cells demonstrated a strong invasive capacity of the ECM in vitro, principally by production of matrix metalloproteinases 2 and 9, and robust pro-angiogenic activity in the chick CAM model, that facilitate its dissemination through same chick embryo internal organs. This study, with the title “MMPs and angiogenesis affect the metastatic potential of a human vulvar leiomyosarcoma cell line”, is presented in the published form. In the second part of this work, the emphasis was given to the microvascular element of the tumour microenvironment and specifically to the perivascular pericytes. These are intriguing cells due to their uncertain involvement in the biology of cancer. It is not clear how pericytes change within the tumour microenvironment and which is their contribute during the tumour dissemination. After the characterization of the chosen pericytic cell model, an in vitro study of the interaction between pericytes and different cancer cell lines where performed. Indirect and direct cell-cell interaction as well as movement of cancer cells in presence of pericytes conditioned media was analysed, in order to investigate the reciprocal influence of pericytes and tumour cells in the context of cancer progression.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Trabalho Final do Curso de Mestrado Integrado em Medicina, Faculdade de Medicina, Universidade de Lisboa, 2014

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Description based on: 7th ed. (1980)

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Vols. for 1982-1985 consist of data from NIGMS human genetic mutant cell repository sponsored by the National Institute of General Medical Sciences, and from NIA aging cell repository sponsored by the National Institute on Aging. Repositories located at the Institute for Medical Research, Camden, N.J.; for 1986/1987- consist of data from NIGMS human genetic mutant cell repository located at Coriell Institute for Medical Research.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Multicellular tumor spheroids (MCTS) are used as organotypic models of normal and solid tumor tissue. Traditional techniques for generating MCTS, such as growth on nonadherent surfaces, in suspension, or on scaffolds, have a number of drawbacks, including the need for manual selection to achieve a homogeneous population and the use of nonphysiological matrix compounds. In this study we describe a mild method for the generation of MCTS, in which individual spheroids form in hanging drops suspended from a microtiter plate. The method has been successfully applied to a broad range of cell lines and shows nearly 100% efficiency (i.e., one spheroid per drop). Using the hepatoma cell line, HepG2, the hanging drop method generated well-rounded MCTS with a narrow size distribution (coefficient of variation [CV] 10% to 15%, compared with 40% to 60% for growth on nonadherent surfaces). Structural analysis of HepG2 and a mammary gland adenocarcinoma cell line, MCF-7, composed spheroids, revealed highly organized, three-dimensional, tissue-like structures with an extensive extracellular matrix. The hanging drop method represents an attractive alternative for MCTS production, because it is mild, can be applied to a wide variety of cell lines, and can produce spheroids of a homogeneous size without the need for sieving or manual selection. The method has applications for basic studies of physiology and metabolism, tumor biology, toxicology, cellular organization, and the development of bioartificial tissue. (C) 2003 Wiley Periodicals, Inc.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Classic Hodgkin's lymphoma (HL) tissue contains a small population of morphologically distinct malignant cells called Hodgkin and Reed-Sternberg (HRS) cells, associated with the development of HL. Using 3'-rapid amplification of cDNA ends ( RACE) we identified an alternative mRNA for the DEC-205 multilectin receptor in the HRS cell line L428. Sequence analysis revealed that the mRNA encodes a fusion protein between DEC-205 and a novel C-type lectin DCL-1. Although the 7.5-kb DEC-205 and 4.2-kb DCL-1 mRNA were expressed independently in myeloid and B lymphoid cell lines, the DEC-205/DCL-1 fusion mRNA (9.5 kb) predominated in the HRS cell lines ( L428, KM-H2, and HDLM-2). The DEC-205 and DCL-1 genes comprising 35 and 6 exons, respectively, are juxtaposed on chromosome band 2q24 and separated by only 5.4 kb. We determined the DCL-1 transcription initiation site within the intervening sequence by 5'-RACE, confirming that DCL-1 is an independent gene. Two DEC-205/DCL-1 fusion mRNA variants may result from cotranscription of DEC-205 and DCL-1, followed by splicing DEC-205 exon 35 or 34-35 along with DCL-1 exon 1. The resulting reading frames encode the DEC-205 ectodomain plus the DCL-1 ectodomain, the transmembrane, and the cytoplasmic domain. Using DCL-1 cytoplasmic domain-specific polyclonal and DEC-205 monoclonal antibodies for immunoprecipitation/Western blot analysis, we showed that the fusion mRNA is translated into a DEC-205/DCL-1 fusion protein, expressed in the HRS cell lines. These results imply an unusual transcriptional control mechanism in HRS cells, which cotranscribe an mRNA containing DEC-205 and DCL-1 prior to generating the intergenically spliced mRNA to produce a DEC-205/DCL-1 fusion protein.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

We have employed an inverse engineering strategy based on quantitative proteome analysis to identify changes in intracellular protein abundance that correlate with increased specific recombinant monoclonal antibody production (qMab) by engineered murine myeloma (NSO) cells. Four homogeneous NSO cell lines differing in qMab were isolated from a pool of primary transfectants. The proteome of each stably transfected cell line was analyzed at mid-exponential growth phase by two-dimensional gel electrophoresis (2D-PAGE) and individual protein spot volume data derived from digitized gel images were compared statistically. To identify changes in protein abundance associated with qMab clatasets were screened for proteins that exhibited either a linear correlation with cell line qMab or a conserved change in abundance specific only to the cell line with highest qMab. Several proteins with altered abundance were identified by mass spectrometry. Proteins exhibiting a significant increase in abundance with increasing qMab included molecular chaperones known to interact directly with nascent immunoglobulins during their folding and assembly (e.g., BiP, endoplasmin, protein disulfide isomerase). 2D-PAGE analysis showed that in all cell lines Mab light chain was more abundant than heavy chain, indicating that this is a likely prerequisite for efficient Mab production. In summary, these data reveal both the adaptive responses and molecular mechanisms enabling mammalian cells in culture to achieve high-level recombinant monoclonal antibody production. (C) 2004 Wiley Periodicals, Inc.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

One common characteristic of breast cancers arising in carriers of the predisposition gene BRCA1 is a loss of expression of the CDK inhibitor p27(Kip1) (p27), suggesting that p27 interacts epistatically with BRCA1. To investigate this relationship, we examined expression of p27 in mice expressing a dominant negative allele of Brca1 (MMTV-trBr) in the mammary gland. While these mice rarely develop tumors, they showed a 50% increase in p27 protein and a delay in mammary gland development associated with reduced proliferation. In contrast, on a p27 heterozygote background, MMTV-trBrca1 mice showed an increase in S phase cells, and normal mammary development. p27 was the only protein in the cyclin cyclin-dependent kinase network to show altered expression, suggesting that it may be a central mediator of cell cycle arrest in response to loss of function of BRCA1. Furthermore, in human mammary epithelial MCF7 cells expressing BRCA1-specific RNAi and in the BRCA1-deficient human tumor cell line HCC1937, p27 is elevated at the mRNA level compared to cells expressing wild-type BRCA1. We hypothesize that disruption of BRCA1 induces an increase in p27 that inhibits proliferation. Accordingly, reduction in p27 expression leads to enhancement of cellular proliferation in the absence of BRCA1.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Trichogramma species are mass-produced for biological control using host eggs. Artificial diets have been developed to reduce production costs, however, most include insect haemolymph as a major component, which still results in a significant expense. Medium conditioned with insect cell lines has produced some success as a haemolymph replacement in artificial diets for several parasitoid wasp species. Trichogramma australicum Girault (Hymenoptera: Trichogrammatidae) was the first species to develop successfully to the adult stage on diets containing concentrated HeliothiS zea (Boddie) (Lepidoptera: Noctuidae) cells. Tricho-gramma pretiosum Riley (Hymenoptera: Trichogrammatidae) was subsequently grown to the adult stage on a similar cell line diet. This success encouraged a systematic investigation into the use of insect cell lines in Trichogramma artificial diets. We compared the effect of diets containing insect cells with diets containing conditioned cell line media. Diets containing insect cells produced significantly more pupae than diets containing conditioned medium and, although not significant, produced a higher number of adults. Second, we compared the effect of diets containing cell lines established from ovary-associated tissue of H. zea and embryo tissue of Aedes albopictus (Skuse) (Diptera: Culicidae) on T pretiosum development. Trichogramma pretiosum development was not significantly different on diets containing cells from the two origins and tissue types. Third, the effect of cell storage on T pretiosum development was observed. HeliothiS zea cells in medium were stored at 4 degrees C and room temperature (22 degrees C for one, two, four and seven days before addition to artificial diets. Cell viability was calculated for these storage treatments. HeliothiS zea cells could be stored at 4 degrees C for up to seven days with no detrimental effect on T pretiosum development. Tricho-gramma pretiosum development did not depend on cell viability. The use of insect cell lines as a haemolymph replacement has the potential to significantly reduce production costs and simplify Trichogramma artificial diets with the eventual aim of replacing host production in mass rearing facilities. (c) 2005 Elsevier Inc. All rights reserved.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Ascoviruses (AVs) infect larvae of various insect pests belonging to the family Noctuidae. The result of AV infection in the hosts is cleavage of infected cells into vesicles, a unique feature of AV infection. Since insect cell lines facilitate the study of virus life cycles, attempts were made to analyze Heliothis virescens AV (HvAV3e) infection in several cell lines and compare cell pathology to larval infection. In this study, replication and cytopathological effects of HvAV3e on four different cell lines were investigated. HvAV3e replication was confirmed in three noctuid cell lines from Spodoptera frugiperda (Sf9) and Helicoverpa zea (BCIRL-Hz-AM1 and FB33). However, the virus did not replicate in the non-noctuid insect cell line from Pieris rapae (Pieridae). Despite replication of the virus in the three permissive cell lines, the cytopathological effects of the virus were significantly different from that of larval infection.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

In Hodgkin lymphoma (HL), the malignant Hodgkin Reed-Sternberg (HRS) cells constitute only 0.5% of 10% of the diseased tissue. The surrounding cellular infiltrate is enriched with T cells that are hypothesized to modulate antitumor immunity. We show that a marker of regulatory T cells, LAG-3, is strongly expressed on infiltrating lymphocytes present in proximity to HRS cells. Circulating regulatory T cells (CD4(+) CD25(hi) CD45 ROhi, CD4(+) CTLA4(hi), and CD4(+) LAG-3(hi)) were elevated in HL patients with active disease when compared with remission. Longitudinal profiling of EBV-specific CD8(+) T-cell responses in 94 HL patients revealed a selective loss of interferon-gamma expression by CD8(+) T cells specific for latent membrane proteins 1 and 2 (LMP1/2), irrespective of EBV tissue status. Intratumoral LAG-3 expression was associated with EBV tissue positivity, whereas FOXP3 was linked with neither LAG-3 nor EBV tissue status. The level of LAG-3 and FOXP3 expression on the tumor-infiltrating lymphocytes was coincident with impairment of LMP1/2-specific T-cell function. In vitro pre-exposure of peripheral blood mono-nuclear cells to HRS cell line supernatant significantly increased the expansion of regulatory T cells and suppressed LMP-specific T-cell responses. Deletion of CD4(+) LAG-3(+) T cells enhanced LMP-specific reactivity. These findings indicate a pivotal role for regulatory T cells and LAG-3 in the suppression of EBV-specific cell-mediated immunity in HL.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Increased expression of the epithelial mucin MUC1 has been linked to tumor aggressiveness in human breast carcinoma. Recent studies have demonstrated that overexpression of MUC1 interferes with cell-substrate and cell-cell adhesion by masking cell surface integrins and E-cadherin. Additionally, the cytoplasmic tail of MUC1 is involved in signal transduction and interactions with catenins. In the present study, we have examined the in vitro expression of MUC1 mRNA and protein in a panel of 14 human breast cancer cell lines using northern blotting, western blotting, immunocytochemistry, and flow cytometry. Considerable variability of expression was noted not only between cell lines but also within several individual lines. Many cell lines such as BT 20, KPL-1, and T47D expressed abundant MUC1 whilst others such as MDA-MB-231 and MCF-7 showed intermediate expression, and MDA-MB-435 and MDA-MB-453 expressed very low levels. Low levels of MUC1 expression were associated with decreased expression of cytokeratin and increased expression of vimentin. Additionally, 12 of the cell lines were established as xenografts in immunocompromised (SCID) mice, and MUC1 expression in both the primary tumors as well as metastases was assessed immunohistochemically. In general, in vivo expression mirrored in vitro expression, although there was reduced in vivo expression in T47D and ZR-75-1 xenografts. Although we showed no correlation between tumorigenicity or metastasis and MUC1 expression, this study will assist development of experimental models to assess the influence of MUC1 of on breast cancer progression.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

To facilitate the study of the regulation and downstream interactions of genes involved in gonad development it is important to have a suitable cell culture model. We therefore aimed to characterize molecularly three different mouse gonad cell lines. TM3 and TM4 cells were originally isolated from prepubertal mouse gonads and were tentatively identified as being of Leydig cell and Sertoli cell origin, respectively, based upon their morphology and hormonal responses. The third line is a conditionally immortalized cell line, derived from 10.5-11.5 days post-coitum (dpc) male gonads of transgenic embryos carrying a temperature-sensitive SV40 large T-antigen. We studied by reverse transcription-polymerase chain reaction (RT-PCR) the expression profiles of a number of genes known to be important for early gonad development. Moreover, we assessed these cell lines for their capacity to induce Sox9 transcription upon expression of Sry, a key molecular event occurring during sex determination. We found that all three cell lines were unable to upregulate Sox9 expression upon transfection of Sry-expression constructs, even though these cells express many of the studied embryonic gonad genes. These observations point to a requirement for SRY cofactors for direct or indirect upregulation of Sox9 expression during testis determination. Copyright © 2003 S. Karger AG, Basel

Relevância:

90.00% 90.00%

Publicador:

Resumo:

1. The calcitonin receptor-like receptor (CRLR) and specific receptor activity modifying proteins (RAMPs) together form receptors for calcitonin gene-related peptide (CGRP) and/or adrenomedullin in transfected cells. 2. There is less evidence that innate CGRP and adrenomedullin receptors are formed by CRLR/RAMP combinations. We therefore examined whether CGRP and/or adrenomedullin binding correlated with CRLR and RAMP mRNA expression in human and rat cell lines known to express these receptors. Specific human or rat CRLR antibodies were used to examine the presence of CRLR in these cells. 3. We confirmed CGRP subtype 1 receptor (CGRP(1)) pharmacology in SK-N-MC neuroblastoma cells. L6 myoblast cells expressed both CGRP(1) and adrenomedullin receptors whereas Rat-2 fibroblasts expressed only adrenomedullin receptors. In contrast we could not confirm CGRP(2) receptor pharmacology for Col-29 colonic epithelial cells, which, instead were CGRP(1)-like in this study. 4. L6, SK-N-MC and Col-29 cells expressed mRNA for RAMP1 and RAMP2 but Rat-2 fibroblasts had only RAMP2. No cell line had detectable RAMP3 mRNA. 5. SK-N-MC, Col-29 and Rat-2 fibroblast cells expressed CRLR mRNA. By contrast, CRLR mRNA was undetectable by Northern analysis in one source of L6 cells. Conversely, a different source of L6 cells had mRNA for CRLR. All of the cell lines expressed CRLR protein. Thus circumstances where CRLR mRNA is apparently absent by Northern analysis do not exclude the presence of this receptor. 6. These data strongly support CRLR, together with appropriate RAMPs as binding sites for CGRP and adrenomedullin in cultured cells.