Central Corneal Thickness in Patients With Systemic Sclerosis: A Controlled Study

Purpose: To compare the central corneal thickness (CCT) of patients with systemic sclerosis (SSc) and control subjects. Methods: The study group comprised 37 consecutive patients with SSc, and the control group comprised 23 healthy individuals similar in age and sex. CCT value was measured by ultrasound pachymetry. Results: In the SSc group, the mean CCT in the right eye was 534.9 +/- 33.5 mu m and 536.9 +/- 32.4 mu m in the left eye. In the control group, the mean CCT was 533.0 +/- 32.9 mu m in the right eye and 533.1 +/- 33.6 mu m in the left eye. The mean CCT was not significantly different in the SSc group compared with the control group for both the right (P = 0.83) and left (P = 0.67) eyes. Conclusions: CCT measurements do not significantly differ in patients with SSc compared with healthy control subjects.

The Role of SRY Mutations in the Etiology of Gonadal Dysgenesis in Patients with 45,X/46,XY Disorder of Sex Development and Variants

Background: The potential involvement of SRY in abnormal gonadal development in 45,X/46,X,der(Y) patients was proposed following the identification of SRY mutations in a few patients with Turner syndrome (TS). However, its exact etiological role in gonadal dysgenesis in patients with Y chromosome mosaicisms has not yet been clarified. Aims: It was the aim of this study to screen for allelic variation in SRY in a large cohort of patients with disorders of sex development due to chromosomal abnormalities with 45, X/46, X, der(Y) karyotype. Patients: Twenty-seven patients, 14 with TS and 13 with mixed gonadal dysgenesis (MGD), harboring 45, X/46, X, der(Y) karyotypes were selected. Methods: Genomic DNA was extracted from peripheral blood leukocytes of all patients and from gonadal tissue in 4 cases. The SRY coding region was PCR amplified and sequenced. Results: We identified only 1 polymorphism (c.561C -> T) in a 45,X/46,XY MGD patient, which was detected in blood and in gonadal tissue. Conclusion: Our results indicate that mutations in SRY are rare findings in patients with Y chromosome mosaicisms. Therefore, a significant role of mutated SRY in the etiology of gonadal dysgenesis in patients harboring 45, X/46, XY karyotype and variants seems very unlikely. Copyright (C) 2010 S. Karger AG, Basel

Novel Heterozygous Nonsense GLI2 Mutations in Patients with Hypopituitarism and Ectopic Posterior Pituitary Lobe without Holoprosencephaly

Context: GLI2 is a transcription factor downstream in Sonic Hedgehog signaling, acting early in ventral forebrain and pituitary development. GLI2 mutations were reported in patients with holoprosencephaly (HPE) and pituitary abnormalities. Objective: The aim was to report three novel frameshift/nonsense GLI2 mutations and the phenotypic variability in the three families. Setting: The study was conducted at a university hospital. Patients and Methods: The GLI2 coding region of patients with isolated GH deficiency (IGHD) or combined pituitary hormone deficiency was amplified by PCR using intronic primers and sequenced. Results: Three novel heterozygous GLI2 mutations were identified: c. 2362_2368del p. L788fsX794 (family 1), c. 2081_2084del p. L694fsX722 (family 2), and c. 1138 G > T p. E380X (family 3). All predict a truncated protein with loss of the C-terminal activator domain. The index case of family 1 had polydactyly, hypoglycemia, and seizures, and GH, TSH, prolactin, ACTH, LH, and FSH deficiencies. Her mother and seven relatives harboring the same mutation had polydactyly, including two uncles with IGHD and one cousin with GH, TSH, LH, and FSH deficiencies. In family 2, a boy had cryptorchidism, cleft lip and palate, and GH deficiency. In family 3, a girl had hypoglycemia, seizures, excessive thirst and polyuria, and GH, ACTH, TSH, and antidiuretic hormone deficiencies. Magnetic resonance imaging of four patients with GLI2 mutations and hypopituitarism showed a hypoplastic anterior pituitary and an ectopic posterior pituitary lobe without HPE. Conclusion: We describe three novel heterozygous frameshift or nonsense GLI2 mutations, predicting truncated proteins lacking the activator domain, associated with IGHD or combined pituitary hormone deficiency and ectopic posterior pituitary lobe without HPE. These phenotypes support partial penetrance, variable polydactyly, midline facial defects, and pituitary hormone deficiencies, including diabetes insipidus, conferred by heterozygous frameshift or nonsense GLI2 mutations. (J Clin Endocrinol Metab 95: E384-E391, 2010)

The role of micro-anchor devices in medial canthopexy

Telecanthus, the lateral displacement of the medial canthus, can be a congenital deformity or can occur after facial trauma or tumor resection. Treatment of telecanthus remains a challenge for plastic surgeons. For proper correction, it is necessary to shift the medial canthus medially, fixing its tendon to the bone. The ideal technique would allow easy, safe, and stable fixation of the tendon, permit a unilateral approach with minimal incisions, and be cost-effective. The purpose of this study was to evaluate the feasibility and results (immediate and long-term) of medial telecanthus repair using ipsilateral titanium microanchor fixation. Nine patients, 7 with unilateral telecanthus and 2 with bilateral telecanthus, underwent ipsilateral canthopexy involving a microanchor device. Anthropometric measurements of the orbital regions were taken before, immediately after, and at 1 year after surgery. Data for the affected sides were compared with those for the unaffected sides, and the evolution of those values was assessed throughout the 1-year follow-up period. For all patients, the final values were lower than those initially obtained. At 1 year after surgery, the intercanthal distance was reduced to age-adjusted normal values in all cases. On the operated side, stable improvement was observed in terms of the distance from the medial canthus to the midline, although some degree of recurrence was noted in most of the patients. The use of a microanchor system for medial canthopexy can be considered an easily performed and effective option for treating canthal dystopia, especially when an ipsilateral approach is preferred.

A transgenic mouse model that recapitulates the clinical features of both neonatal and adult forms of the skin disease epidermolytic hyperkeratosis

Keratins are the major structural proteins of keratinocytes, which are the most abundant cell type in the mammalian epidermis. Mutations in epidermal keratin genes have been shown to cause severe blistering skin abnormalities. One such disease, epidermolytic hyperkeratosis (EHK), also known as bullous congenital ichthyosiform erythroderma, occurs as a result of mutations in highly conserved regions of keratins K1 and K10. Patients with EHK first exhibit erythroderma with severe blistering, which later is replaced by thick patches of scaly skin. To assess the effect of a mutated K1 gene on skin biology and to produce an animal model for EHK, we removed 60 residues from the 2B segment of HK1 and observed the effects of its expression in the epidermis of transgenic mice. Phenotypes of the resultant mice closely resembled those observed in the human disease, first with epidermal blisters, then later with hyperkeratotic lesions. In neonatal mice homozygous for the transgene, the skin was thicker, with an increased labeling index, and the spinous cells showed a collapse of the keratin filament network around the nuclei, suggesting that a critical concentration of the mutant HK1, over the endogenous MK1, was required to disrupt the structural integrity of the spinous cells. Additionally, footpad epithelium, which is devoid of hair follicles, showed blistering in the spinous layer, suggesting that hair follicles can stabilize or protect the epidermis from trauma. Blisters were not evident in adult mice, but instead they showed a thick, scaly hyperkeratotic skin with increased mitosis, resulting in an increased number of corneocytes and granular cells. Irregularly shaped keratohyalin granules were also observed. To date, this is the only transgenic model to show the typical morphology found in the adult form of EHK.

Urodynamic evaluation in diabetic patients with prostate enlargement and lower urinary tract symptoms

Introduction: Lower urinary tract symptoms ( LUTS) are common in men over 50 years of age due to prostate enlargement. Diabetes mellitus is also more prevalent in this group. LUTS may result from bladder outlet obstruction ( BOO) secondary to prostate enlargement or bladder dysfunction secondary to diabetes or even from a combination of both. Objectives: The objective of this study was to determine the prevalence of BOO and other urodynamic abnormalities in diabetic patients with LUTS and enlarged prostate. A secondary objective was to assess the predictive value of non-invasive tests for BOO diagnosis in this group of patients. Patients and Methods: 50 consecutive diabetic patients with enlarged prostate and LUTS were evaluated by the International Prostate Symptom Score ( IPSS), ultra sonography and urodynamics. BOO diagnosis was based on pressure/ flow measurements according to the International Continence Society`s standards. Results: Of the 50 patients in the study, 23 ( 46%) had BOO. There was no correlation between the IPSS, uroflowmetry, post- voiding residual urine or prostate volume and the presence of BOO ( p > 0.05). Conclusions: There is a relatively low prevalence of BOO in diabetic patients with prostate enlargement and LUTS. Non- invasive tests did not allow the identification of these subjects. Only urodynamic evaluation is able to determine symptom etiology. Copyright (c) 2008 S. Karger AG, Basel.

Use of an Inflatable Silicone Balloon Improves the Success Rate of Bladder Autoaugmentation at Long-Term Followup

Purpose: Most groups have reported disappointing results with autoaugmentation or detrusor myectomy for low capacity/compliance neuropathic bladders. Failure may be due to an ischemic diverticulum or mucosal shrinkage. We investigated whether a Silimed (R) silicone balloon placed in the bladder after autoaugmentation could prevent these problems, improving surgical results. Materials and Methods: We compared the results of standard bladder autoaugmentation in 12 children (group 1) with those in 10 (group 2) who underwent the same surgery using a bladder conformer. The conformer was a silicone balloon filled with saline that remained in the bladder for 2 weeks. All patients had a neuropathic bladder with poor capacity and compliance, resulting in urinary leakage between catheterizations. Preoperative and postoperative evaluation included a voiding diary, ultrasound, voiding cystourethrogram and urodynamics. Results: In group 1 only 1 patient became dry, 4 had little improvement in continence, 4 remained unchanged and 3 became worse. In group 2, 6 patients (60%) become continent without medication, 2 (20%) become continent with oxybutynin and 2 remained unchanged. Bladder capacity and compliance did not change significantly in group 1. However, in group 2 capacity changed from a mean of 140 to 240 ml and mean +/- SD compliance increased from 15.6 +/- 16.8 to 34.3 +/- 22.8 ml/cm H(2)O (p = 0.02). Conclusions: The inflatable balloon improved our long-term results of bladder auto-augmentation. A larger series may be necessary to confirm procedure efficacy and safety.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Digital vasculitis in systemic lupus erythematosus: a minor manifestation of disease activity?

The objective of this study is to determine if digital vasculitis (DV), a clinical manifestation with a high systemic lupus erythematosus disease activity index (SLEDAI) score, is associated with lupus severity. DV and other clinical manifestations defined according to the SLEDAI were evaluated in 168 consecutive patients with systemic lupus erythematosus (SLE). Two groups were defined according to presence (DV+, n = 27) or absence of DV (DV-, n = 141) at the time of evaluation. The exclusion criterion was the presence of antiphospholipid syndrome (Sapporo`s criteria). The two groups were comparable with regard to age (P = 0.09), gender (P = 1.00), white race (P = 0.81), and disease duration (P = 0.78). Compared to the DV-group, the DV+ group had a significantly higher frequency of mucocutaneous manifestations (66.7 vs. 39.0%, P = 0.01), haematological abnormalities (22.2 vs. 6.4%, P = 0.02) and constitutional symptoms (11.1 vs. 0.7%, P = 0.01). Renal and neurological involvements were similar in both groups ( P = 0.57 and P = 1.00, respectively). The evaluation of each SLEDAI parameter confirmed that the DV+ group had higher frequencies of mild manifestations, such as new rash (P = 0.02), alopecia (P = 0.02), oral ulcers (P = 0.045), fever (P = 0.01) and leucopenia (P = 0.005). In contrast, both groups had similarly increased anti-dsDNA (P = 0.78) and decreased complement levels (P = 0.29). In conclusion, DV in patients with SLE identifies a subgroup of a mild disease. The high `weighted` index attributed to this alteration in the SLEDAI score should therefore be revised. Lupus (2009) 18, 990-993.

Centrilobular Fibrosis: An Underrecognized Pattern in Systemic Sclerosis

Background: The impressive association of lung involvement and gastroesophageal reflux in scleroderma raises the possibility of a cause-effect relationship. Objectives: To determine clinical, radiological and histopathological features of systemic sclerosis (SSc) patients according the presence or absence of centrilobular fibrosis (CLF). Methods: Twenty-eight SSc patients with lung involvement were submitted to open lung biopsy and the specimens classified for the presence of CLF (bronchocentric distribution of the lesions and intraluminal matter according to the classification of idiopathic interstitial pneumonia). HRCT, pulmonary function tests and esophageal analysis were also performed. Subsequently, cyclophosphamide was introduced for the nonspecific interstitial pneumonia subgroup and antireflux treatment was intensified for isolated CLF patients. Results: Isolated CLF was found in 21% of the biopsies and also found associated to nonspecific interstitial pneumonia in 84% of these patients. The other 3 cases had usual interstitial pneumonia, pulmonary hypertension and respiratory bronchiolitis-associated interstitial lung disease. The histopathological analysis revealed that all 6 patients with isolated CLF had the bronchocentric distribution and intraluminal basophilic content, with foreign bodies detected in one third of them. The central distribution of lung involvement on HRCT was found in 67% of these patients with a consistent patchy distribution (100%). Ground glass (67%) and consolidation (33%) were the predominant patterns found. The constant clinical finding in all isolated CLF cases was dyspnea, esophageal abnormalities and a moderate lung impairment (FVC: 63.83 +/- 16.31%; DLCO: 61.66 +/- 18.84%). Lung function parameters in isolated CLF patients remained stable after 1 year of exclusively intensive antireflux treatment (FVC, p = 0.23; DLCO, p = 0.59). Conclusions: The novel description of CLF pattern in SSc lung disease with peculiar histological, tomographic and clinical features will certainly contribute to a more appropriate therapeutic approach. Copyright (C) 2008 S. Karger AG, Basel

Menstrual and hormonal alterations in juvenile systemic lupus erythematosus

Menstrual cycles of 30 patients with juvenile systemic lupus erythematosus (JSLE) were compared with 30 age-matched controls. The mean age of patients with JSLE and controls was similar (17.4 +/- 3.2 vs 17.06 +/- 2.08 years, P = 0.66). The mean menarche age was higher in JSLE than controls (13.13 +/- 1.4 vs 11.56 +/- 1.5 years, P = 0.0008). On the contrary, the mean maternal menarche age was similar in both groups (P = 0.62). Menstrual abnormalities and longer length cycles were more frequently observed in JSLE than controls (63% vs 10%, P = 0.0001; 23% vs 0%, P = 0.0105, respectively). The median of follicle stimulating hormone was significantly higher in patients with JSLE compared with controls (4.6 vs 3.4 IU/L, P = 0.0207), and the median of progesterone was lower (32.5 vs 70 ng/mL, P = 0.0033). The median Of luteinizing hormone was lower in patients with JSLE with menstrual abnormalities versus normal cycles (2.9 vs 5.5 IU/L, P = 0.019) and both had a high percentage of decreased progesterone levels (63% vs 73%, P = 0.70). Our findings support the notion that menstrual disturbances are frequent and may be associated with pituitary dysfunction leading to a decreased progesterone production. We also reported that in spite of premature ovarian failure being a rare event in JSLE the follicular reserve seems to be low regardless of intravenous cyclophosphamide treatment. Lupus (2009) 18, 38-43.

Testicular Sertoli cell function in male systemic lupus erythematosus

Objective. To assess the testicular Sertoli cell function in male SLE patients. Methods. Thirty-four consecutive patients were prospectively selected to evaluate serum inhibin B. Clinical features, treatment, semen analysis, urological evaluation, testicular ultrasound, hormones and anti-sperm antibodies were determined. Results. Patients were subdivided into two groups: low serum inhibin B (Group 1, n = 8) and normal levels (Group 2, n 26). The median sperm concentration (P = 0.024), total sperm count (P = 0.023) and total motile sperm count (P = 0.025) were lower in Group 1. Inhibin B levels were positively correlated with sperm concentration (r = 0.343), total motile sperm count (r = 0.357), and negatively correlated with follicule-stimulating hormone (FSH) (r = 0.699) and luteinizing hormone (r = 0.397). The median serum inhibin B was lower in SLE patients treated with intravenous cyclophosphamide (IVCYC) compared with those without this therapy (P = 0.031). Further evaluation of the 26 SLE patients with normal inhibin B and FSH levels revealed that medians of inhibin B/FSH ratio were lower in SLE patients with oligozoospermia compared with normozoospermia (P = 0.004). This ratio was also lower in SLE patients treated with IVCYC than those without this therapy (P = 0.04). In contrast, inhibin B serum level alone did not discriminate the later group of patients (P = 0.12). Conclusions. This is the first study to identify a high frequency of testicular Sertoli cell dysfunction in male SLE associated with semen abnormalities. Further prospective studies are necessary to determine if inhibin levels and inhibin B/FSH ratio will be an earlier and useful marker of IVCYC toxicity in these patients.

Clues for Previously Undiagnosed Connective Tissue Disease in Patients With Trigeminal Neuralgia

Background: Connective tissue diseases (CTD) may be associated with idiopathic trigeminal neuralgia (TN). The prevalence and diagnostic implications of this association are, however, not well established. Objectives: The objective of this study was to evaluate, in TN patients, if rheumatologic clinical and laboratory findings could contribute to the early diagnosis of rheumatic diseases. Methods: Forty-six consecutive TN patients, 67% female, mean disease duration 8.78 +/- 7.25 years, and 47 controls were initially interviewed using a standard questionnaire based on common signs/symptoms of systemic lupus erythematosus, Sjogren syndrome, mixed CTD, and systemic sclerosis. Autoantibodies were detected by standard techniques. Those with rheumatologic complaints or positive autoantibodies were referred to the Rheumatology Outpatient Clinic for a more detailed evaluation. Secondary causes of TN were excluded. Results: The frequency of Raynaud phenomenon (P = 0.026) and ANA reactivity (P = 0.04) were significantly higher in TN patients compared with controls. Fourteen TN patients were ANA positive. Seven of them reported concomitant rheumatic complaints, and interestingly, diffuse CTD was diagnosed in 4 (57%) of these patients: 1 systemic lupus erythematosus; 2 Sjogren syndrome; and 1 undifferentiated disease with scleritis and positive parotid scintigraphy. In all cases, TN preceded by at least 10 months the rheumatologic signs/symptoms. Moreover, these 4 TN patients with CTD had a higher frequency of sicca symptoms (P = 0.001) and higher titers of ANA (>= 1:320) (P = 0.006) than the remaining 42 TN patients without CTD diagnoses. Sixteen patients had isolated laboratory or clinical abnormalities, and none of them had CTD diagnoses. Conclusions: The concomitant presence of sicca symptoms and high titer ANA are clues for the early investigation of rheumatic diseases in TN patients.

Menstrual and hormonal alterations in juvenile dermatomyositis

Objective To evaluate age at menarche, menstrual cycles and hormone profile in juvenile dermatomyositis (JDM) patients and controls. Methods Twelve consecutive JDM patients were compared to 24 age-matched healthy subjects. Age at menarche and age of maternal menarche were recorded. Menstrual cycle was evaluated prospectively for 6 consecutive months and the mean cycle length and flow were calculated. The hormone profile was collected on the last menstrual cycle. Demographic data, clinical features, muscle enzymes, JDM scores and treatment were analysed. Results The median of current age of JDM patients and controls was similar (18 vs. 17 years, p=0.99). The median age at menarche of the JDM patients was higher than in the control group (13 vs. 11 years, p=0.02) whereas the median age of maternal menarche was alike in both groups (12 vs. 13 years, p=0.67). Menstrual disturbances were not observed, except for one patient who had longer length of menstrual cycle. The median of follicle stimulating hormone (FSH) was significantly higher in JDM patients compared to controls (4.5 vs. 3.0 IU/L, p=0.02) and none of them had premature ovarian failure (POF). The median of progesterone was significantly lower in JDM patients (0.3 vs. 0.7 ng/mL, p=0.01) with a higher frequency of decreased progesterone compared to controls (75% vs. 29%, p=0.01). Conclusions Our study identifies in JDM patients delayed menarche with normal cycles and low follicular reserve. The decreased progesterone levels may suggest an underlying subclinical corpus luteum dysfunction in this disease.

Characterisation of five missense mutations in the cystathionine beta-synthase gene from three patients with B-6-nonresponsive homocystinuria

Homocystinuria, due to a deficiency of the enzyme cystathionine beta-synthase (CBS), is an inborn error of sulphur-amino acid metabolism, This is an autosomal recessive disease which results in hyperhomocysteinaemia and a wide range of clinical features, including optic lens dislocation, mental retardation, skeletal abnormalities and premature thrombotic events, We report the identification of 5 missense mutations in the protein-coding region of the CBS gene from 3 patients with pyridoxine-nonresponsive homocystinuria. Reverse-transcription PCR was used to amplify CBS cDNA from each patient and the coding region was analysed by direct sequencing, The mutations detected included 3 novel (1058C --> T, 992C --> A and 1316G --> A) and 2 previously identified (430G --> A and 833C --> T) base alterations in the CBS cDNA, Each of these mutations predicts a single amino acid substitution in the CBS polypeptide, Appropriate cassettes of patient CBS cDNA, containing each of the above defined mutations, were used to replace the corresponding cassettes of normal CBS cDNA sequence within the bacterial expression vector pT7-7. These recombinant mutant and normal CBS constructs were expressed in Escherichia coli cells and the catalytic activities of the mutant proteins were compared with normal. All of the mutant proteins exhibited decreased catalytic activity in vitro, which confirmed the association between the individual mutation and CBS dysfunction in each patient.