984 resultados para Susceptibility gene


Relevância:

20.00% 20.00%

Publicador:

Resumo:

N-Acetylglucosamine (GlcNAc) is the major immunoepitope of group A streptococcal cell wall carbohydrates. Antistreptococcal antibodies cross-reactive with anti-GlcNAc and laminin are present in sera of patients with rheumatic fever. The cross-reactivity of these antibodies with human heart valvular endothelium and the underlying basement membrane has been suggested to be a possible cause of immune-mediated valve lesion. Mannose-binding lectin (MBL) encoded by the MBL2 gene, a soluble pathogen recognition receptor, has high affinity for GlcNAc. We postulated that mutations in exon 1 of the MBL2 gene associated with a deficient serum level of MBL may contribute to chronic severe aortic regurgitation (AR) of rheumatic etiology. We studied 90 patients with severe chronic AR of rheumatic etiology and 281 healthy controls (HC) for the variants of the MBL2 gene at codons 52, 54, and 57 by using a PCR-restriction fragment length polymorphism-based method. We observed a significant difference in the prevalence of defective MBL2 alleles between patients with chronic severe AR and HC. Sixteen percent of patients with chronic severe AR were homozygotes or compound heterozygotes for defective MBL alleles in contrast to 5% for HC (P = 0.0022; odds ratio, 3.5 [ 95% confidence interval, 1.6 to 7.7]). No association was detected with the variant of the MASP2 gene. Our study suggests that MBL deficiency may contribute to the development of chronic severe AR of rheumatic etiology.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Myb is a key transcription factor that can regulate proliferation, differentiation, and apoptosis, predominantly in the haemopoietic system. Abnormal expression of Myb is associated with a number of cancers, both haemopoietic and non-haemopoietic. In order to better understand the role of Myb in normal and tumorigenic processes, we undertook a cDNA array screen to identify genes that are regulated by this factor. In this way, we identified the gene encoding vascular endothelial growth factor (VEGF) as being potentially regulated by the Myb oncoprotein in myeloid cells. To determine whether this was a direct effect on VEGF gene transcription, we examined the activity of the murine VEGF promoter in the presence of either wild-type (WT) or mutant forms of Myb. It was found that WT Myb was able to activate the VEGF promoter and that a minimal promoter region of 120 bp was sufficient to confer Myb responsiveness. Surprisingly, activation of the VEGF promoter was independent of DNA binding by Myb. This was shown by the use of DNA binding-defective Myb mutants and by mutagenesis of a potential Myb-binding site in the minimal promoter. Mutation of Sp1 sites within this region abolished Myb-mediated regulation of a reporter construct, suggesting that Myb DNA binding-independent activation of VEGF expression occurs via these Sp1 binding elements. Regulation of VEGF production by Myb has implications for the potential role of Myb in myeloid leukaemias and in solid tumours where VEGF may be functioning as an autocrine growth factor. (c) 2006 Elsevier Inc. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Background Women with 21-hydroxylase deficiency present much variability in external genitalia virilization, even among those with similar impairments of 21-hydroxylase (21OH) activity. Objective To evaluate if the number of CAG (nCAG) repeats of the androgen receptor gene influences the degree of external genitalia virilization in women with CYP21A2 mutations, grouped according to impairment of 21OH activity. Patients The nCAG was determined in 106 congenital adrenal hyperplasia (CAH) patients and in 302 controls. The patients were divided, according to their CYP21A2 genotypes, into Groups A and B, which confer total and severe impairment of 21OH activity, respectively. Methods The inactivation pattern of the X-chromosome was studied through genomic DNA digestion with Hpa II. The CAG repeat region was amplified by polymerase chain reaction (PCR) and analysed by GeneScan. Results The nCAG and the frequency of severe skewed X-inactivation did not differ between normal women and patients. The nCAG median in genotype A was 20.7 (IQR 2.3) for Prader I + II, 22.5 (3.6) for Prader III and 21 (2.9) for Prader IV + V (P < 0.05 for Prader III and Prader IV + V). The nCAG median in genotype B was 21.3 (1.1) for Prader I + II, 20.5 (2.9) for Prader III and 22 (2.8) for Prader IV + V (P > 0.05). A significant difference was found regarding the nCAG median in patients presenting Prader III from genotypes A and B. Conclusions We observed great variability in the degree of external genitalia virilization in both CYP21A2 genotypes, and we showed that the CAG repeats of the androgen receptor gene influences this phenotypic variability.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Autoimmune rheumatic diseases are generally considered as a multifactorial aetiology, mainly genetic susceptibility combined with environmental triggers of which bacteria are considered one of the most prominent. Among the rheumatic diseases where bacterial agents are more clearly involved as triggers are: reactive arthritis (ReA), rheumatic fever (RF) and Lyme disease. The role of bacterial infections in inducing other seronegative spondyloarthritis and antiphospholipid antibody syndrome has been hypothesized but is still not proven. The classic form of ReA is associated with the presence of HLA-B27 and is triggered by the urethritis or enteritis causing pathogens Chlamydia trachomatis and the enterobacteria Salmonella, Shigella, and Yersinia, respectively. But several other pathogens such as Brucella, Leptospira, Mycobacteria, Neisseria, Staphylococcus and Streptococcus have also been reported to cause ReA. RF is due to an autoimmune reaction triggered by an untreated throat infection by Streptococcus pyogenes in susceptible individuals. Carditis is the most serious manifestation of RF and HLA-DR7 is predominantly observed in the development of valvular lesions. Lyme disease is a tick-transmitted disease caused by the spirochete Borrelia burgdorferi. Knowledge is limited about how this spirochete interacts with human tissues and cells. Some data report that Borrelia burgdorferi can manipulate resident cells towards a pro- but also anti-inflammatory reaction and persist over a long period of time inside the human body or even inside human cells.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Infections caused by the yeast Candida albicans represent an increasing threat to debilitated and immunosuppressed patients, and neutropenia is an important risk factor. Monoclonal antibody depletion of neutrophils in mice was used to study the role of these cells in host resistance. Ablation of neutrophils increased susceptibility to both systemic and vaginal challenge. The fungal burden in the kidney increased threefold on day 1, and 100-fold on day 4, and infection was associated with extensive tissue destruction. However, a striking feature of the disseminated disease in neutrophil-depleted animals was the altered pattern of organ involvement. The brain, which is one of the primary target organs in normal mice, was little affected. There was a threefold increase in the number of organisms recovered from the brains of neutrophil-depleted mice on day 4 after infection, but detectable abscesses were rare. In contrast, the heart, which in normal mice shows only minor lesions, developed severe tissue damage following neutrophil depletion. Mice deficient in C5 demonstrated both qualitative and quantitative increases in the severity of infection after neutrophil depletion when compared with C5-sufficient strains. The results are interpreted as reflecting organ-specific differences in the mechanisms of host resistance.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Context: A better means to accurately identify malignant thyroid nodules and to distinguish them from benign tumors is needed. We previously identified markers for detecting thyroid malignancy, with sensitivity estimated at or close to 100%. One lingering problem with these markers was that false positives occurred with Hurthle cell adenomas (HCA) which lowered test specificity. Methods: To locate accurate diagnostic markers, we profiled in depth the transcripts of a HCA and a Hurthle cell carcinoma (HCC). From 1146 differentially expressed genes, 18 transcripts specifically expressed in HCA were tested by quantitative PCR in a wide range of thyroid tumors (n = 76). Sensibility and specificity were calculated using receiver operating characteristic (ROC). Selected markers were further validated in an independent set of thyroid tumors (n = 82) by immunohistochemistry. To define the panel that would yield best diagnostic accuracy, these markers were tested in combination with our previous identified markers. Results: Seventeen of the 18 genes showed statistical significance based on a mean relative level of expression (P < 0.05). KLK1 (sensitivity = 0.97) and PVALB (sensitivity = 0.94) were the best candidate markers. The combination of PVALB and C1orf24 increased specificity to > 97% and maintained sensitivity for detection of carcinoma. Conclusion: We identified tumor markers that can be used in combination for a more accurate preoperative diagnosis of thyroid nodules and for postoperative diagnosis of thyroid carcinoma in tumor sections. This improved test would help physicians rapidly focus treatment on true malignancies and avoid unnecessary treatment of benign tumors, simultaneously improving medical care and reducing costs. (J Clin Endocrinol Metab 96: E151-E160, 2011)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

An efficient system is now in place for improving diverse sugarcane cultivars by genetic transformation, that is, the insertion of useful new genes into single cells followed by the regeneration of genetically modified (transgenic) plants. The method has already been used to introduce genes for resistance to several major diseases, insect pests and a herbicide, Field testing has begun, and research is underway to identify other genes for increased environmental stress resistance, agronomic efficiency and yield of sucrose or other valuable products. Experience in other crops has shown that genetically improved varieties which provide genuine environmental and consumer benefits are welcomed by producers and consumers. Substantial research is still needed, but these new gene technologies will reshape the sugar industry and determine the international competitive efficiency of producers.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The genetic mechanisms responsible for the formation of adrenocortical adenomas which autonomously produce aldosterone are largely unknown, The adrenal renin-angiotensin system has been implicated in the pathophysiology of these tumours, Angiotensin-converting enzyme (ACE) catalyses the generation of angiotensin II, and the insertion/deletion (I/D) polymorphism of the ACE gene regulates up to 50% of plasma and cellular ACE variability in humans. We therefore examined the genotypic and allelic frequency distributions of the ACE gene I/D polymorphism in 55 patients with aldosterone-producing adenoma, APA, (angiotensin-unresponsive APA n = 28, angiotensin-responsive APA n = 27), and 80 control subjects with no family history of hypertension, We also compared the ACE gene I/D polymorphism allelic pattern in matched tumour and peripheral blood DNA in the 55 patients with APA, The frequency of the D allele was 0.518 and 0.512 and the I allele was 0.482 and 0.488 in the APA and control subjects respectively, Genotypic and allelic frequency analysis found no significant differences between the groups, Examination of the matched tumour and peripheral blood DNA samples revealed the loss of the insertion allele in four of the 25 patients who were heterozygous for the ACE I/D genotype. The I/D polymorphism of the ACE gene does not appear to contribute to the biochemical and phenotypic characteristics of APA, however, the deletion of the insertion allele of the ACE gene I/D polymorphism in 16% of aldosterone-producing adenomas may represent the loss of a tumour suppressor gene/s or other genes on chromosome 17q which may contribute to tumorigenesis in APA.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to investigate loss of heterozygosity (LOH) of the APC tumor suppressor gene loci, using restriction fragment length polymorphism-polymerase chain reaction (RFLP-PCR) in 40 cases of oral squamous cell carcinoma (OSCC). Observed informativity was 72.5% for APC exon 11 and 82.5% for APC exon 15. LOH at APC exon 11 was observed in 2 (6.9%) of 29 informative cases, and no LOH was observed for APC exon 15. Our results suggest that inactivation of the APC gene plays a minor role in the carcinogenesis of OSCC. (C) 2008 Elsevier GmbH. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Context: Thyroglobulin (TG) is a large glycoprotein and functions as a matrix for thyroid hormone synthesis. TG gene mutations give rise to goitrous congenital hypothyroidism (CH) with considerable phenotype variation. Objectives: The aim of the study was to report the genetic screening of 15 patients with CH due to TG gene mutations and to perform functional analysis of the p. A2215D mutation. Design: Clinical evaluation and DNA sequencing of the TG gene were performed in all patients. TG expression was analyzed in the goitrous tissue of one patient. Human cells were transfected with expression vectors containing mutated and wild-type human TG cDNA. Results: All patients had an absent rise of serum TG after stimulation with recombinant human TSH. Sequence analysis revealed three previously described mutations (p. A2215D, p. R277X, and g. IVS30 + 1G > T), and two novel mutations (p. Q2142X and g. IVS46-1G > A). Two known (g. IVS30 + 1G/p. A2215D and p. A2215D/p. R277X) and one novel (p. R277X/g. IVS46-1G > A) compound heterozygous constellations were also identified. Functional analysis indicated deficiency in TG synthesis, reduction of TG secretion, and retention of the mutant TG within the cell, leading to an endoplasmic reticulum storage disease, whereas small amounts of mutant TG were still secreted within the cell system. Conclusion: All studied patients were either homozygous or heterozygous for TG gene mutations. Two novel mutations have been detected, and we show that TG mutation p. A2215D promotes the retention of TG within the endoplasmic reticulum and reduces TG synthesis and secretion, causing mild hypothyroidism. In the presence of sufficient iodine supply, some patients with TG mutations are able to compensate the impaired hormonogenesis and generate thyroid hormone. (J Clin Endocrinol Metab 94: 2938-2944, 2009)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Context: Necdin activates GNRH gene expression and is fundamental for the development, migration, and axonal extension of murine GNRH neurons. In humans, necdin plays a potential role in the hypogonadotropic hypogonadism phenotype in patients with Prader-Willi syndrome. Aim: To investigate necdin gene (NDN) variants in patients with isolated hypogonadotropic hypogonadism (IHH). Patients and methods: We studied 160 Brazilian patients with IHH, which includes 92 with Kallmann syndrome and 68 with normosmic IHH. Genomic DNA was extracted and the single NDN exon was amplified and sequenced. To measure GNRH transcriptional activity, luciferase reporter plasmids containing GNRH regulatory regions were transiently transfected into GT1-7 cells in the presence and absence of overexpressed wild-type or mutant necdin. Results: A heterozygous variant of necdin, p.V318A, was identified in a 23-year-old male with Kallmann syndrome. The p.V318A was also present in affected aunt and his father and was absent in 100 Brazilian control subjects. Previous FGFR1 gene analysis revealed a missense mutation (p.P366L) in this family. Functional studies revealed a minor difference in the activation of GNRH transcription by mutant protein compared with wild type in that a significant impairment of the necdin protein activity threshold was observed. Conclusion: A rare variant of necdin (p.V318A) was described in a family with Kallmann syndrome associated with a FGFR1 mutation. Familial segregation and in vitro analysis suggested that this non-synonymous variant did not have a direct causative role in the hypogonadism phenotype. NDN mutations are not a frequent cause of congenital IHH.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Lima GA, Anhe GF, Giannocco G, Nunes MT, Correa-Giannella ML, Machado UF. Contractile activity per se induces transcriptional activation of SLC2A4 gene in soleus muscle: involvement of MEF2D, HIF-1a, and TR alpha transcriptional factors. Am J Physiol Endocrinol Metab 296: E132-E138, 2009. First published October 28, 2008; doi: 10.1152/ajpendo.90548.2008.-Skeletal muscle is a target tissue for approaches that can improve insulin sensitivity in insulin-resistant states. In muscles, glucose uptake is performed by the GLUT-4 protein, which is encoded by the SLC2A4 gene. SLC2A4 gene expression increases in response to conditions that improve insulin sensitivity, including chronic exercise. However, since chronic exercise improves insulin sensitivity, the increased SLC2A4 gene expression could not be clearly attributed to the muscle contractile activity per se and/or to the improved insulin sensitivity. The present study was designed to investigate the role of contractile activity per se in the regulation of SLC2A4 gene expression as well as in the participation of the transcriptional factors myocyte enhancer factor 2D (MEF2D), hypoxia inducible factor 1a (HIF-1a), and thyroid hormone receptor-alpha (TR alpha). The performed in vitro protocol excluded the interference of metabolic, hormonal, and neural effects. The results showed that, in response to 10 min of electrically induced contraction of soleus muscle, an early 40% increase in GLUT-4 mRNA (30 min) occurred, with a subsequent 65% increase (120 min) in GLUT-4 protein content. EMSA and supershift assays revealed that the stimulus rapidly increased the binding activity of MEF2D, HIF-1a, and TR alpha into the SLC2A4 gene promoter. Furthermore, chromatin immunoprecipitation assay confirmed, in native nucleosome, that contraction induced an approximate fourfold (P < 0.01) increase in MEF2D and HIF-1a-binding activity. In conclusion, muscle contraction per se enhances SLC2A4 gene expression and that involves MEF2D, HIF-1a, and TR alpha transcription factor activation. This finding reinforces the importance of physical activity to improve glycemic homeostasis independently of other additional insulin sensitizer approaches.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Polymorphisms in the methylenetetrahydrofolate reductase (MTHFR), methionine synthase reductase (MTRR) and cystathionine P-synthase (CBS) genes, involved in the intracellular metabolism of homocysteine (Hcy), can result in hyperhomocysteinemia. The objective of this study was to evaluate prevalence estimates of CBS T833C, G919A and the insertion of 68-bp (844ins68) polymorphisms and their correlation with Hcy, folate and 131, in 220 children previously genotyped for MTHFR C677T, A1298C, and MTRR A66G. The prevalence of heterozygote children for 844ins68 was 19.5%. The T833C CBS mutation was identified in association with 844ins68 in all the carriers of the insertion. Genotyping for CBS G919A mutation showed that all the children presented the GG genotype. Analysis of Hcy, B(12) and folate, according to the combination of the different genotypes of the C677T and A1298C MTHFR, A66G MTRR, and 844ins68 CBS showed that the 677TT/1298AA/68WW genotype is associated with an increase in Hcy, when compared to the 677CC/1298AC/68WW (P = 0.033) and the 677CT/1298AA/68WW genotypes (P = 0.034). Since B(12) and folate were not different between these groups, a genetic interaction between diverse polymorphisms probably influences Hcy. Our results emphasize the role of genetic interactions in Hcy levels. (C) 2008 Wiley-Liss, Inc.