990 resultados para Ruthenium compounds


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fac-ruthenium(II) tris-(5-carboxy-2,2'-bipyridine) has been synthesised as a single geometric isomer for the first time, and proves to be a good "building-block" to introduce new functionality with retention of the isomeric integrity.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Monomeric ruthenium(II) complexes [Ru(L)3]2+ containing unsymmetric bipyridine ligands [Where L = 5-methyl-2,2'-bipyridine (L1), 5-ethyl-2,2'-bipyridine (L2), 5-propyl-2,2'-bipyridine (L3), 5-(2-methylpropyl)-2,2'-bipyridine (L4), 5-(2,2-dimethylpropyl)-2,2'-bipyridine (L5) and 5-(carbomethoxy)-2,2'-bipyridine (L6)] have been studied and the meridional and facial isomers isolated by the use of cation-exchange column chromatography (SP Sephadex C-25) eluting with either sodium toluene-4-sulfonate or sodium hexanoate. The relative yield of the facial isomer was found to decrease with increasing steric bulk, preventing the isolation of fac-[Ru(L5)3]2+. The two isomeric forms were characterized by 1H NMR, with the complexes [Ru(L1-3)3]2+ demonstrating an unusually large coupling between the H6 and H4 protons. Crystals suitable for X-ray structural analysis of [Ru(L1)3]2+ were obtained as a mixture of the meridional and facial isomers, indicating that separation of this isomeric mixture could not be achieved by fractional crystallisation. The optical isomers of the complex [Ru(L3)3]2+ were chromatographically separated on SP Sephadex C-25 relying upon the inherent chirality of the support. It is apparent that chiral interactions can inhibit geometric isomer separation using this technique.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Volatile organic compound (VOC) contamination of subsurface geological material and groundwater was discovered on the Nortel Monkstown industrial site, Belfast, Northern Ireland. The objectives of this study were to (1) investigate the characteristics of the geological material and its influences on contaminated groundwater flow across the site using borehole logs and hydrological evaluations, and (2) identify the contaminants and examine their distribution in the subsurface geological material and groundwater using chemical analysis. This report focuses on the eastern car park (ECP) which was a former storage area associated with trichloroethene (TCE) degreasing operations. This is where the greatest amount of volatile organic compounds (VOCs), particularly TCE, were detected. The study site is on a complex deposit of clayey glacial till with discontinuous coarser grained lenses, mainly silts, sands and gravel, which occur at 0.45–7.82 m below ground level (bgl). The lenses overall form an elongated formation that acts as a small unconfined shallow aquifer. There is a continuous low permeable stiff clayey till layer beneath the lenses that performs as an aquitard to the groundwater. Highest concentrations of VOCs, mainly TCE, in the geological material and groundwater are in these coarser lenses at ~4.5–7 m bgl. Highest TCE measurements at 390,000 µg L-1 for groundwater and at 39,000 µg kg-1 at 5.7 m for geological material were in borehole GA19 in the coarse lens zone. It is assumed that TCE gained entrance to the subsurface near this borehole where the clayey till was thin to absent above coarse lenses which provided little retardation to the vertical migration of this dense non-aqueous phase liquid (DNAPL) into the groundwater. However, TCE is present in low concentrations in the geological material overlying the coarse lens zone. Additionally, VOCs appear to be associated with poorly drained layers and in peat

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A versatile approach for the enantioselective synthesis of functionalised beta-hydroxy N-acetylcysteamine thiol esters has been developed which allows the facile incorporation of isotopic labels. It has been shown that a remarkable reversal of selectivity occurs in the titanium mediated aldol reaction of the acyloxazolidone intermediate using either (S)- or (R)-tert-butyldimethylsilyloxybutanal. The aldol products are valuable intermediates in the synthesis of 4-hydroxy-6-substituted gamma-lactones.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Two series of ruthenium(II) polypyridyl complexes [Ru(bipy)2(phpytr)]+ and [Ru(bipy)2(phpztr)]+ (where Hphpytr = 2-(5-phenyl-1H-[1,2,4]triazol-3-yl)-pyridine and Hphpztr = 2-(5-phenyl-1H-[1,2,4]triazol-3-yl)-pyrazine) are examined by electrochemistry, UV/Vis, emission, resonance Raman, transient resonance Raman and transient absorption spectroscopy, in order to obtain a more comprehensive understanding of their excited state electronic properties. The interpretation of the results obtained is facilitated by the availability of several isotopologues of each of the complexes examined. For the pyridine-1,2,4-triazolato based complex the lowest emissive excited state is exclusively bipy based, however, for the pyrazine based complexes excited state localisation on particular ligands shows considerable solvent and pH dependency.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The coronavirus main protease, Mpro, is considered a major target for drugs suitable to combat coronavirus infections including the severe acute respiratory syndrome (SARS). In this study, comprehensive HPLC- and FRET-substrate-based screenings of various electrophilic compounds were performed to identify potential Mpro inhibitors. The data revealed that the coronaviral main protease is inhibited by aziridine- and oxirane-2-carboxylates. Among the trans-configured aziridine-2,3-dicarboxylates the Gly-Gly-containing peptide 2c was found to be the most potent inhibitor.