972 resultados para Non specific lumbar pain


Relevância:

30.00% 30.00%

Publicador:

Resumo:

Beta cell destruction in type 1 diabetes (TID) is associated with cellular oxidative stress and mitochondrial pathway of cell death. The aim of this study was to determine whether oxidative stress and mitochondrial dysfunction are present in T1D model (non-obese diabetic mouse, NOD) and if they are related to the stages of disease development. NOD mice were studied at three stages: non-diabetic, pre-diabetic, and diabetic and compared with age-matched Balb/c mice. Mitochondria respiration rates measured at phosphorylating and resting states in liver and soleus biopsies and in isolated liver mitochondria were similar in NOD and Balb/c mice at the three disease stages. However, NOD liver mitochondria were more susceptible to calcium-induced mitochondrial permeability transition as determined by cyclosporine-A-sensitive swelling and by decreased calcium retention capacity in all three stages of diabetes development. Mitochondria H2O2 production rate was higher in non-diabetic, but unaltered in pre-diabetic and diabetic NOD mice. The global cell reactive oxygen species (ROS), but not specific mitochondria ROS production, was significantly increased in NOD lymphomononuclear and stem cells in all disease stages. In addition, marked elevated rates of 2',7'-dichlorodihydrofluorescein (H2DCF) oxidation were observed in pancreatic islets from non-diabetic NOD mice. Using matrix-assisted laser desorption/ionization (MALDI) mass spectrometry (MS) and lipidomic approach, we identified oxidized lipid markers in NOD liver mitochondria for each disease stage, most of them being derivatives of diacylglycerols and phospholipids. These results suggest that the cellular oxidative stress precedes the establishment of diabetes and may be the cause of mitochondrial dysfunction that is involved in beta cell death.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The present study evaluated the role of N-methyl-D-aspartate receptors (NMDARs) expressed in the dorsal root ganglia (DRG) in the inflammatory sensitization of peripheral nociceptor terminals to mechanical stimulation. Injection of NMDA into the fifth lumbar (L5)-DRG induced hyperalgesia in the rat hind paw with a profile similar to that of intraplantar injection of prostaglandin E2 (PGE2), which was significantly attenuated by injection of the NMDAR antagonist D(-)-2-amino-5-phosphonopentanoic acid (D-AP-5) in the L5-DRG. Moreover, blockade of DRG AMPA receptors by the antagonist 6,7-dinitroquinoxaline-2,3-dione had no effect in the PGE2-induced hyperalgesia in the paw, showing specific involvement of NMDARs in this modulatory effect and suggesting that activation of NMDAR in the DRG plays an important role in the peripheral inflammatory hyperalgesia. In following experiments we observed attenuation of PGE2-induced hyperalgesia in the paw by the knockdown of NMDAR subunits NR1, NR2B, NR2D, and NR3A with antisense-oligodeoxynucleotide treatment in the DRG. Also, in vitro experiments showed that the NMDA-induced sensitization of cultured DRG neurons depends on satellite cell activation and on those same NMDAR subunits, suggesting their importance for the PGE2-induced hyperalgesia. In addition, fluorescent calcium imaging experiments in cultures of DRG cells showed induction of calcium transients by glutamate or NMDA only in satellite cells, but not in neurons. Together, the present results suggest that the mechanical inflammatory nociceptor sensitization is dependent on glutamate release at the DRG and subsequent NMDAR activation in satellite glial cells, supporting the idea that the peripheral hyperalgesia is an event modulated by a glutamatergic system in the DRG.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

OBJECTIVES: To evaluate the effect of a chewing exercise on pain intensity and pressure-pain threshold in patients with myofascial pain. METHODS: Twenty-nine consecutive women diagnosed with myofascial pain (MFP) according to the Research Diagnostic Criteria comprised the experimental group and 15 healthy age-matched female were used as controls. Subjects were asked to chew a gum stick for 9 min and to stay at rest for another 9 min afterwards. Pain intensity was rated on a visual analog scale (VAS) every 3 min. At 0, 9 and 18 min, the pressure-pain threshold (PPT) was measured bilaterally on the masseter and the anterior, medium, and posterior temporalis muscles. RESULTS: Patients with myofascial pain reported increase (76%) and no change (24%) on the pain intensity measured with the VAS. A reduction of the PPT at all muscular sites after the exercise and a non-significant recovery after rest were also observed. CONCLUSION: The following conclusions can be drawn: 1. there are at least two subtypes of patients with myofascial pain that respond differently to experimental chewing; 2. the chewing protocol had an adequate discriminative ability in distinguishing patients with myofascial pain from healthy controls.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Nerve injury leads to a neuropathic pain state that results from central sensitization. This phenomenom is mediated by NMDA receptors and may involve the production of nitric oxide (NO). In this study, we investigated the expression of the neuronal isoform of NO synthase (nNOS) in the spinal cord of 3-month-old male, Wistar rats after sciatic nerve transection (SNT). Our attention was focused on the dorsal part of L3-L5 segments receiving sensory inputs from the sciatic nerve. SNT resulted in the development of neuropathic pain symptoms confirmed by evaluating mechanical hyperalgesia (Randall and Selitto test) and allodynia (von Frey hair test). Control animals did not present any alteration (sham-animals). The selective inhibitor of nNOS, 7-nitroindazole (0.2 and 2 µg in 50 µL), blocked hyperalgesia and allodynia induced by SNT. Immunohistochemical analysis showed that nNOS was increased (48% by day 30) in the lumbar spinal cord after SNT. This increase was observed near the central canal (Rexed’s lamina X) and also in lamina I-IV of the dorsal horn. Real-time PCR results indicated an increase of nNOS mRNA detected from 1 to 30 days after SNT, with the highest increase observed 1 day after injury (1469%). Immunoblotting confirmed the increase of nNOS in the spinal cord between 1 and 15 days post-lesion (20%), reaching the greatest increase (60%) 30 days after surgery. The present findings demonstrate an increase of nNOS after peripheral nerve injury that may contribute to the increase of NO production observed after peripheral neuropathy.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Non-coding RNAs (ncRNAs) were recently given much higher attention due to technical advances in sequencing which expanded the characterization of transcriptomes in different organisms. ncRNAs have different lengths (22 nt to >1, 000 nt) and mechanisms of action that essentially comprise a sophisticated gene expression regulation network. Recent publication of schistosome genomes and transcriptomes has increased the description and characterization of a large number of parasite genes. Here we review the number of predicted genes and the coverage of genomic bases in face of the public ESTs dataset available, including a critical appraisal of the evidence and characterization of ncRNAs in schistosomes. We show expression data for ncRNAs in Schistosoma mansoni. We analyze three different microarray experiment datasets: (1) adult worms' large-scale expression measurements; (2) differentially expressed S. mansoni genes regulated by a human cytokine (TNF-α) in a parasite culture; and (3) a stage-specific expression of ncRNAs. All these data point to ncRNAs involved in different biological processes and physiological responses that suggest functionality of these new players in the parasite's biology. Exploring this world is a challenge for the scientists under a new molecular perspective of host-parasite interactions and parasite development.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

This work presents a fully non-linear finite element formulation for shell analysis comprising linear strain variation along the thickness of the shell and geometrically exact description for curved triangular elements. The developed formulation assumes positions and generalized unconstrained vectors as the variables of the problem, not displacements and finite rotations. The full 3D Saint-Venant-Kirchhoff constitutive relation is adopted and, to avoid locking, the rate of thickness variation enhancement is introduced. As a consequence, the second Piola-Kirchhoff stress tensor and the Green strain measure are employed to derive the specific strain energy potential. Curved triangular elements with cubic approximation are adopted using simple notation. Selected numerical simulations illustrate and confirm the objectivity, accuracy, path independence and applicability of the proposed technique.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Background: Expectation is a very potent pain modulator in both humans and animals. There is evidence that pain transmission neurons are modulated by expectation preceding painful stimuli. Nonetheless, few studies have examined the influence of pain expectation on the pain-related neuronal activity and the functional connectivity within the central nociceptive network. Results: This study used a tone-laser conditioning paradigm to establish the pain expectation in rats, and simultaneously recorded the anterior cingulate cortex (ACC), the medial dorsal thalamus (MD), and the primary somatosensory cortex (SI) to investigate the effect of pain expectation on laser-induced neuronal responses. Cross-correlation and partial directed coherence analysis were used to determine the functional interactions within and between the recorded areas during nociceptive transmission. The results showed that under anticipation condition, the neuronal activity to the auditory cue was significantly increased in the ACC area, whereas those to actual noxious stimuli were enhanced in all the recorded areas. Furthermore, neuronal correlations within and between these areas were significantly increased under conditions of expectation compared to those under non-expectation conditions, indicating an enhanced synchronization of neural activity within the pain network. In addition, information flow from the medial (ACC and MD) to the lateral (SI cortex) pain pathway increased, suggesting that the emotion-related neural circuits may modulate the neuronal activity in the somatosensory pathway during nociceptive transmission. Conclusion: These results demonstrate that the nociceptive processing in both medial and lateral pain systems is modulated by the expectation of pain.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) plays an important role in the life cycle of the Trypanosoma cruzi, and an immobilized enzyme reactor (IMER) has been developed for use in the on-line screening for GAPDH inhibitors. An IMER containing human GAPDH has been previously reported; however, these conditions produced a T. cruzi GAPDH-IMER with poor activity and stability. The factors affecting the stability of the human and T. cruzi GAPDHs in the immobilization process and the influence of pH and buffer type on the stability and activity of the IMERs have been investigated. The resulting T. cruzi GAPDH-IMER was coupled to an analytical octyl column, which was used to achieve chromatographic separation of NAD+ from NADH. The production of NADH stimulated by D-glyceraldehyde-3-phosphate was used to investigate the activity and kinetic parameters of the immobilized T. cruzi GAPDH. The Michaelis-Menten constant (K-m) values determined for D-glyceraldehyde-3-phosphate and NAD(+) were K-m = 0.5 +/- 0.05 mM and 0.648 +/- 0.08 mM, respectively, which were consistent with the values obtained using the non-immobilized enzyme.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Background: Prostate cancer cells in primary tumors have been typed CD10(-)/CD13(-)/CD24(hi)/CD26(+)/CD38(lo)/CD44(-)/CD104(-). This CD phenotype suggests a lineage relationship between cancer cells and luminal cells. The Gleason grade of tumors is a descriptive of tumor glandular differentiation. Higher Gleason scores are associated with treatment failure. Methods: CD26(+) cancer cells were isolated from Gleason 3+3 (G3) and Gleason 4+4 (G4) tumors by cell sorting, and their gene expression or transcriptome was determined by Affymetrix DNA array analysis. Dataset analysis was used to determine gene expression similarities and differences between G3 and G4 as well as to prostate cancer cell lines and histologically normal prostate luminal cells. Results: The G3 and G4 transcriptomes were compared to those of prostatic cell types of non-cancer, which included luminal, basal, stromal fibromuscular, and endothelial. A principal components analysis of the various transcriptome datasets indicated a closer relationship between luminal and G3 than luminal and G4. Dataset comparison also showed that the cancer transcriptomes differed substantially from those of prostate cancer cell lines. Conclusions: Genes differentially expressed in cancer are potential biomarkers for cancer detection, and those differentially expressed between G3 and G4 are potential biomarkers for disease stratification given that G4 cancer is associated with poor outcomes. Differentially expressed genes likely contribute to the prostate cancer phenotype and constitute the signatures of these particular cancer cell types.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Interference by autofluorescence is one of the major concerns of immunofluorescence analysis of in situ hybridization-based diagnostic assays. We present a useful technique that reduces autofluorescent background without affecting the tissue integrity or direct immunofluorescence signals in brain sections. Using six different protocols, such as ammonia/ethanol, Sudan Black B (SBB) in 70% ethanol, photobleaching with UV light and different combinations of them in both formalin-fixed paraffin-embedded and frozen human brain tissue sections, we have found that tissue treatment of SBB in a concentration of 0.1% in 70% ethanol is the best approach to reduce/eliminate tissue autofluorescence and background, while preserving the specific fluorescence hybridization signals. This strategy is a feasible, non-time consuming method that provides a reasonable compromise between total reduction of the tissue autofluorescence and maintenance of specific fluorescent labels.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Background: Few cohort studies have been conducted in low and middle-income countries to investigate non-communicable diseases among school-aged children. This article aims to describe the methodology of two birth cohorts, started in 1994 in Ribeirao Preto (RP), a more developed city, and in 1997/98 in Sao Luis (SL), a less developed town. Methods: Prevalences of some non-communicable diseases during the first follow-up of these cohorts were estimated and compared. Data on singleton live births were obtained at birth (2858 in RP and 2443 in SL). The follow-up at school age was conducted in RP in 2004/05, when the children were 9-11 years old and in SL in 2005/06, when the children were 7-9 years old. Follow-up rates were 68.7% in RP (790 included) and 72.7% in SL (673 participants). The groups of low (<2500 g) and high (>= 4250 g) birthweight were oversampled and estimates were corrected by weighting. Results: In the more developed city there was a higher percentage of non-nutritive sucking habits (69.1% vs 47.9%), lifetime bottle use (89.6% vs 68.3%), higher prevalence of primary headache in the last 15 days (27.9% vs 13.0%), higher positive skin tests for allergens (44.3% vs 25.3%) and higher prevalence of overweight (18.2% vs 3.6%), obesity (9.5% vs 1.8%) and hypertension (10.9% vs 4.6%). In the less developed city there was a larger percentage of children with below average cognitive function (28.9% vs 12.2%), mental health problems (47.4% vs 38.4%), depression (21.6% vs 6.0%) and underweight (5.8% vs 3.6%). There was no difference in the prevalence of bruxism, recurrent abdominal pain, asthma and bronchial hyperresponsiveness between cities. Conclusions: Some non-communicable diseases were highly prevalent, especially in the more developed city. Some high rates suggest that the burden of non-communicable diseases will be high in the future, especially mental health problems.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Aims. Given that in most cases just thermal pressure is taken into account in the hydrostatic equilibrium equation to estimate galaxy cluster mass, the main purpose of this paper is to consider the contribution of all three non-thermal components to total mass measurements. The non-thermal pressure is composed by cosmic rays, turbulence and magnetic pressures. Methods. To estimate the thermal pressure we used public XMM-Newton archival data of five Abell clusters to derive temperature and density profiles. To describe the magnetic pressure, we assume a radial distribution for the magnetic field, B(r) proportional to rho(alpha)(g). To seek generality we assume alpha within the range of 0.5 to 0.9, as indicated by observations and numerical simulations. Turbulent motions and bulk velocities add a turbulent pressure, which is considered using an estimate from numerical simulations. For this component, we assume an isotropic pressure, P(turb) = 1/3 rho(g)(sigma(2)(r) + sigma(2)(t)). We also consider the contribution of cosmic ray pressure, P(cr) proportional to r(-0.5). Thus, besides the gas (thermal) pressure, we include these three non-thermal components in the magnetohydrostatic equilibrium equation and compare the total mass estimates with the values obtained without them. Results. A consistent description for the non-thermal component could yield a variation in mass estimates that extends from 10% to similar to 30%. We verified that in the inner parts of cool core clusters the cosmic ray component is comparable to the magnetic pressure, while in non-cool core clusters the cosmic ray component is dominant. For cool core clusters the magnetic pressure is the dominant component, contributing more than 50% of the total mass variation due to non-thermal pressure components. However, for non-cool core clusters, the major influence comes from the cosmic ray pressure that accounts for more than 80% of the total mass variation due to non-thermal pressure effects. For our sample, the maximum influence of the turbulent component to the total mass variation can be almost 20%. Although all of the assumptions agree with previous works, it is important to notice that our results rely on the specific parametrization adopted in this work. We show that this analysis can be regarded as a starting point for a more detailed and refined exploration of the influence of non-thermal pressure in the intra-cluster medium (ICM).

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Prolonged standing has been associated with the onset of low back pain symptoms in working populations. So far, it is unknown how individuals with chronic low back pain (CLBP) behave during prolonged unconstrained standing (PS). The aim of the present study was to analyze the control of posture by subjects with CLBP during PS in comparison to matched healthy adults. The center of pressure (COP) position of 12 CLBP subjects and 12 matched healthy controls was recorded in prolonged standing (30 min) and quiet stance tasks (60 s) on a force plate. The number and amplitude of COP patterns, the root mean square (RMS), speed, and frequency of COP sway were analyzed. Statistical analyses showed that CLBP subjects produced less Postural changes in the antero-posterior direction with decreased postural sway during the prolonged standing task in comparison to the healthy group. Only CLBP subjects were influenced by the prolonged standing task, as demonstrated by their increased COP RMS, COP speed and COP frequency in the quiet standing trial after the prolonged standing task in comparison to the pre-PS trial. The present study provides additional evidence that individuals with CLBP might have altered sensory-motor function. Their inability to generate responses similar to those of healthy subjects during prolonged standing may contribute to CLBP persistence or an increase risk of recurrent back pain episodes. Moreover, quantification of postural changes during prolonged standing could be useful to identify CLBP subjects prone to postural control deficits. (C) 2008 Elsevier B.V. All rights reserved.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Objective: Postural assessment through photography is a simple method that allows the acquisition of quantitative values to define the alignment of body segments. The purpose of this study was to quantitatively assess the postural alignment of several body segments in standing through anterior, posterior, and lateral views. Methods: In this cross-sectional study, 122 subjects were initially evaluated. Seven subjects were excluded from the study after cluster analysis. The final sample had 115 subjects, 75% women with a mean age of 26 + 7 years. Photographs were taken from anterior, posterior, and lateral views after placement of markers on specific anatomical points. Photographs were analyzed using free Postural Analysis Software/Software of Postural Analysis (PAS/SAPO). Quantitative values for postural analysis variables were ascertained for head, upper and lower limbs, and trunk, along with the frequency of inclinations to the left and to the right. Results: Regarding the head, 88% of the sample presented some inclination, 67% of which was to the right. There was a predominance of right inclination of the shoulder and pelvis in 68% and 43% of study subjects, respectively. Lower limbs presented mean alignment of 178 in the anterior view, and the trunk showed predominant right inclination in 66% of participants. Conclusion: Small asymmetries were observed in anterior and posterior views. This study suggests that there is no symmetry in postural alignment and that small asymmetries represent the normative standard for posture in standing. (J Manipulative Physiol Ther 2011;34:371-380)