999 resultados para Ecologia de Ecossistemas


Relevância:

10.00% 10.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Flavobacterium columnare is the causative agent of columnaris disease in freshwater fish, implicated in skin and gill disease, often causing high mortality. The aim of this study was the isolation and characterization of Flavobacterium columnare in tropical fish in Brazil. Piracanjuba (Brycon orbignyanus), pacu (Piaractus mesopotamicus), tambaqui (Colossoma macropomum) and cascudo (Hypostomus plecostomus) were examined for external lesions showing signs of colunmaris disease such as greyish white spots, especially on the head, dorsal part and caudal fin of the fish. The sampling comprised 50 samples representing four different fish species selected for study. Samples for culture were obtained by skin and kidney scrapes with a sterile cotton swabs of columnaris disease fish and streaked onto Carlson and Pacha (1968) artificial culture medium (broth and solid) which were used for isolation. The strains in the liquid medium were Gram negative, long, filamentous, exhibited flexing movements (gliding motility), contained a large number of long slender bacteria and gathered into ‘columns'. Strains on the agar produced yellow-pale colonies, rather small, flat that had rhizoid edges. A total of four Flavobacterium columnare were isolated: 01 Brycon orbignyanus strain, 01 Piaractus mesopotamicus strain, 01 Colossoma macropomum strain, and 01 Hypostomus plecostomus strain. Biochemical characterization, with its absorption of Congo red dye, production of flexirubin-type pigments, H2S production and reduction of nitrates proved that the isolate could be classified as Flavobacterium columnare.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

O domínio do Cerrado compreende uma área contínua nos estados centrais do Brasil e áreas disjuntas em outros estados, incluindo São Paulo. Essa vegetação ocupava originalmente 21% do território brasileiro, restando atualmente apenas 21,6% de sua extensão original. A área recoberta por essa vegetação em São Paulo cobria 14% de sua área total e seus remanescentes recobrem menos de 1% da ocorrência original dessa vegetação. Estudos recentes indicam que o valor da produtividade líquida no Cerrado Pé-de-Gigante (SP) constitui um pequeno dreno de carbono e indicou que a sazonalidade foi o fator determinante do valor observado. Os estudos dos fluxos de carbono em ecossistemas terrestres são raramente acompanhados de abordagens ecofisiológicas de modo a explorar a relação funcional das espécies que compõem o ecossistema e os valores líquidos obtidos para o mesmo. Assim, o objetivo deste trabalho foi caracterizar estruturalmente a vegetação presente na área de maior influência da torre de fluxo instalada no Cerrado Pé-de-Gigante, visando possibilitar estudos relacionados à quantificação em longo prazo da dinâmica dos fluxos de água, energia e CO2 na vegetação de Cerrado. Para isso foram levantadas 20 parcelas (10 x 10 m) em 0,2 ha de Cerrado, e amostraram-se todas as plantas com perímetro ao nível do solo >6 cm (exceto lianas e árvores mortas). A distribuição das classes de diâmetro e estrutura vertical, assim como os parâmetros fitossociológicos foram analisados. Encontramos 1451 indivíduos, distribuídos em 85 espécies, 52 gêneros e 31 famílias. A densidade absoluta e área basal foram de 7255 ind. ha-1 e de 7,9 m².ha-1, respectivamente. A família Leguminosae apresentou o maior número de espécies (13). O Índice de diversidade de Shannon (H') foi 3,27 nats.ind-1. A distribuição em classes de diâmetro mostrou uma curva de "J" invertido, estando a maioria dos indivíduos na primeira classe. Concluímos que a área deve ser classificada como Cerrado denso, devido principalmente à dominância pela espécie arbórea Anadenanthera falcata, cuja ocorrência no estado foi relatada apenas em locais com solos ricos em saturação de bases na região das Cuestas Basálticas, devido também à maior área basal dos indivíduos, comparando com outros fragmentos de Cerrado. Além da espécie citada, Myrcia lingua e Xylopia aromatica, apresentaram os maiores IVI (Valor de importância).

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Echinolaena inflexa (Poir.) Chase is an abundant C3 grass species with high biomass production in the Brazilian savanna (cerrado); Melinis minutiflora Beauv. is an African C4 forage grass widespread in cerrado and probably displacing some native herbaceous species. In the present work, we analysed seasonally the content and composition of soluble carbohydrates, the starch amounts and the above-ground biomass (phytomass) of E. inflexa and M. minutiflora plants harvested in two transects at 5 and 130 m from the border in a restrict area of cerrado at the Biological Reserve and Experimental Station of Mogi-Guaçu (SP, Brazil). Results showed that water soluble carbohydrates and starch amounts from the shoots of both species varied according to the time of the year, whilst in the underground organs, variations were observed mainly in relation to the transects. Marked differences in the pattern of the above-ground biomass production between these two grasses relative to their location in the Reserve were also observed, with two peaks of the invasive species (July and January) at the Reserve border. The differences in carbohydrate accumulation, partitioning and composition of individual sugars concerning time of the year and location in the Reserve were more related to the annual growth cycle of both grasses and possibly to specific physiological responses of M. minutiflora to disturbed environments in the Reserve border.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Phytoplankton may function as a "sensor" of changes in aquatic environment and responds rapidly to such changes. In freshwaters, coexistence of species that have similar ecological requirements and show the same environmental requirements frequently occurs; such species groups are named functional groups. The use of phytoplankton functional groups to evaluate these changes has proven to be very useful and effective. Thus, the aim of this study was to evaluate the occurrence of functional groups of phytoplankton in two reservoirs (Billings and Guarapiranga) that supply water to millions of people in São Paulo city Metropolitan Area, southeastern Brazil. Surface water samples were collected monthly and physical, chemical and biological (quantitative and qualitative analyses of the phytoplankton) were performed. The highest biovolume (mm³.L-1) of the descriptor species and functional groups were represented respectively by Anabaena circinalis Rabenh. (H1), Microcystis aeruginosa (Kützing) Kützing (L M/M) and Mougeotia sp. (T) in the Guarapiranga reservoir and Cylindrospermopsis raciborskii (Wolosz.) Seen. and Subba Raju (S N), Microcystis aeruginosa and M. panniformis Komárek et al. (L M/M), Planktothrix agardhii (Gom.) Anagn. and Komárek and P. cf. clathrata (Skuja) Anagn. and Komárek (S1) in the Billings reservoir. The environmental factors that most influenced the phytoplankton dynamics were water temperature, euphotic zone, turbidity, conductivity, pH, dissolved oxygen, nitrate and total phosphorous.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Increased tourist activity in coastal regions demands management strategies to reduce impacts on rocky shores. The highly populated coastal areas in southeastern Brazil are an example of degradation caused by development of industry and tourism. Among different shore impacts, trampling has been intensively studied, and may represent a significant source of stress for intertidal fauna. A randomised blocks design was applied to experimentally study the effects of two different trampling intensities on richness, diversity, density and biomass of the rocky shore fauna of Obuseiro beach, Guarujá, southeastern Brazil. Blocks were distributed in two portions of the intertidal zone, dominated respectively by Chthamalus bisinuatus (Cirripedia) and Isognomon bicolor (Bivalvia). Blocks were trampled over three months, simulating the vacation period in Brazil and were monitored for the following nine months. Results indicate that Chthamalus bisinuatus is vulnerable to trampling impacts. Richness, diversity and turn-over index tended to be higher in trampled plots four months after trampling ceased. In general, results agree with previous trampling studies, suggesting that even low intensities of trampling may cause some impact on intertidal communities. Management strategies should include isolation of sensitive areas, construction of boardwalks, visitor education and monitoring programmes. In Brazil, additional data obtained from experimental studies are necessary in order to achieve a better understanding of trampling impacts on rocky shore communities.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The influence of the golden lion tamarin (Leontopithecus rosalia) as a seed disperser was studied by monitoring two groups of tamarins from December 1998 to December 2000 (871.9 hours of observations) in a forest fragment in south-east Brazil. The tamarins consumed fruits of 57 species from at least 17 families. They ingested the seeds of 39 species, and 23 of these were put to germinate in the laboratory and/or in the field. L. rosalia is a legitimate seed disperser because the seeds of all species tested germinated after ingestion, albeit some in low percentages. These primates do not show a consistent effect in final seed germination, because they benefit some species while damaging others. Feces were examined for seeds that had been preyed upon or digested.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Os Cerrados sul-americanos abrigam alta diversidade de répteis, incluindo elevado número de endemismos. No entanto, o conhecimento desta diversidade é ainda incompleto frente à acelerada transformação das paisagens naturais no Brasil central. Constituem, portanto, uma das regiões prioritárias para estudo e conservação da biodiversidade mundial. Estudos intensivos sobre a fauna de répteis do Cerrado são necessários e urgentes para melhor compreensão dos processos que levaram à sua origem e distribuição e para subsidiar ações de conservação. Por meio de métodos padronizados, amostramos duas regiões ainda inexploradas da Estação Ecológica Serra Geral do Tocantins, situada na região do Jalapão. Registramos 45 espécies de répteis para a EESGT e entorno, o que representa uma riqueza alta e comparável à de outras regiões bem amostradas do Cerrado. Curvas de acumulação e estimadores indicam que a riqueza local de lagartos e anfisbenídeos aproxima-se da riqueza real enquanto a de serpentes é subestimada. A distribuição não-aleatória das espécies na paisagem concorda com evidências anteriores sugerindo utilização diferencial dos hábitats pelos répteis. Reunindo os resultados do presente estudo com os de levantamentos prévios realizados na região, registramos 88 espécies de répteis para o Jalapão sendo oito registros novos que incluem Bachia oxyrhina uma espécie recém descrita da região. As espécies da área apresentam três padrões gerais de distribuição: (1) espécies endêmicas do Cerrado, (2) espécies compartilhadas com domínios da diagonal de formações abertas sul-americanas, e (3) espécies de ampla ocorrência, compartilhadas também com ecossistemas florestais. Prevalecem espécies de ampla distribuição, porém é grande o número de espécies típicas do Cerrado, incluindo cinco possivelmente endêmicas do Jalapão, e há contribuição importante da fauna da Caatinga. A distribuição dos répteis em escala local e regional demonstra a necessidade de considerar a heterogeneidade paisagística para o planejamento de diretrizes visando à conservação em regiões do Cerrado. Por sua grande extensão, posição biogeográfica e complexidade de relevo e tipos de hábitat, a EESGT tem papel fundamental para a preservação e conhecimento da diversidade de répteis do Cerrado.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Abelhas das orquídeas (Apini, Euglossina) apresentam distribuição principalmente Neotropical, com cerca de 200 espécies e cinco gêneros descritos. Muitos levantamentos locais de fauna estão disponíveis na literatura, mas estudos comparativos sobre a composição e distribuição dos Euglossina são ainda escassos. O objetivo deste estudo é analisar os dados disponíveis de 29 assembleias a fim de entender os padrões gerais de distribuição espacial nas áreas amostradas ao longo do Neotrópico. Métodos de ordenação (DCA e NMDS) foram utilizados para descrever os agrupamentos de assembleias de acordo com as ocorrências de abelhas das orquídeas. As localidades de florestas da América Central e da Amazônia formaram grupos coesos em ambas as análises, enquanto as localidades de Mata Atlântica ficaram mais dispersas nos gráficos. Localidades na margem leste da Amazônia aparecem como áreas de transição características entre esta sub-região e a Mata Atlântica. As análises de variância entre o primeiro eixo da DCA e variáveis selecionadas apresentaram valores significantes quanto à influência dos gradientes de latitude, longitude e precipitação, bem como das sub-regiões biogeográficas nos agrupamentos das assembleias. O padrão geral encontrado é congruente com os padrões biogeográficos previamente propostos para a região Neotropical. Os resultados do DCA auxiliam ainda a identificar, de forma independente, os elementos das faunas de cada uma das formações vegetais estudadas.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

We studied the ecology and natural history of the globally threatened and poorly known Akodon lindberghi Hershkovitz, 1990 in Parque Nacional da Serra da Canastra (PNSC) and Juiz de Fora (JF), southeastern Brazil. From November 1998 to September 2001 a total of 131 individuals were captured in wire-cage live-traps and 52 by pitfalls traps. They were all marked and released at the site. The largest abundances were registered during the dry season, and most of the captures occurred in open habitats. The mean body mass of the two populations was significantly different (18.1 g at PNSC versus 13.1 g at JF; H = 46.2678, g.l.=2, p<0.001). In PNSC, individuals were reproductively active from August to February, and juveniles were present from May to August. The results suggest that the changes in vegetation structure caused by deforestation and intensive agricultural activities could increase the predation rate, affecting the mean body mass of the population.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

INTRODUCTION: This paper reports, for the first time, the presence of the Eratyrus mucronatus species in the State of Rondonia, Brazil. METHODS: These specimens were caught by chance in the forest and later they were collected using luminous traps. RESULTS: After finding these specimens, the number of the Triatominae genera in Rondonia rose to four, while its species rose to seven. CONCLUSIONS: Complimentary studies will be conducted in order to allow for clearer understanding the ecology of this arthropod, its possible role in transmitting Chagas' disease and its current geographical distribution.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

In order to verify the influence of chronic and acute ambient oxygen levels from egg to adult stage of the zebrafish, in vivo oxygen consumption (MO2), critical tensions of oxygen (Pcrit), heart rate (fH) and total body lactate concentration (Lc) were determined for Danio rerio (Hamilton, 1822) raised at 28 °C under normoxic (7.5 mgO2.L-1 or 80 mm.Hg-1) and hypoxic conditions (4.3 mgO2.L-1) and exposed to acute hypoxia during different developmental stages. Our findings confirmed that very early stages do not respond effectively to ambient acute hypoxia. However, after the stage corresponding to the age of 30 days, D. rerio was able to respond to acute hypoxia through effective physiological mechanisms involving aerobic and anaerobic metabolism. Such responses were more efficient for the fishes reared under hypoxia which showed that D. rerio survival capability increased during acclimation to mild hypoxia. Measurements of body mass and length showed that moderate hypoxia did not affect growth significantly until the fish reached the stage of 60 days. Moreover, a growth delay was verified for the hypoxic-reared animals. Also, the D. rerio eggs-to-larvae survival varied from 87.7 to 62.4% in animals reared under normoxia and mild hypoxia, respectively. However, the surviving animals raised under moderated hypoxia showed a better aptitude to regulate aerobic and anaerobic capacities when exposed to acute hypoxia.