871 resultados para stated preferences
Resumo:
Foragers of several species of stingless bees deposit pheromone spots in the vegetation to guide recruited nestmates to a rich food source. Recent studies have shown that Trigona and Scaptotrigona workers secrete these pheromones from their labial glands. An earlier report stated that species within the genus Geotrigona use citral from their mandibular glands for scent marking. Since convincing experimental proof for this conjecture is lacking, we studied the glandular origin of the trail pheromone of Geotrigona mombuca. In field bioassays, newly recruited bees were diverted by artificial scent trails that branched off from the natural scent trail deposited by their nestmates only when they were baited with extracts from the foragers` labial glands. Compounds extracted from the mandibular glands, however, did not release trail following behavior. This demonstrates that the trail pheromone of G. mombuca is produced in the labial glands, as in Trigona and Scaptotrigona. Furthermore, in chemical analyses citral was identified exclusively in the foragers` mandibular glands, which disproves its supposed role as a trail pheromone. The labial glands contained a series of terpene- and wax type esters, with farnesyl butanoate as major constituent. We, therefore, postulate that the trail pheromone of G. mombuca is composed of a blend of esters.
Resumo:
The object of this study is to assess informative possibilities of some technical indicators of the Test of Photos of Professions (BBT - Berufsbilder test), a projective method to clarify professional inclination, proposed by Martin Achtnich. This psychological evaluation technique is composed of 96 photos of professionals, performing various types of activities. The test subject classifies the photos into three groups: positive (agreeable), negative (disagreeable) and indifferent (neutral). Among those chosen positively, five preferences are chosen and a story is developed that includes them, an activity that is requested two times during the Vocational Guidance process: in the beginning (or middle) and at the end of the intervention. In this study, 160 stories were created by 80 youths, between 15 and 20 years of age, in public and private schools in a mid-sized Brazilian city. The stories were compared in three analytical categories: protagonist, professional conflict and resolution. The results were submitted to Wilcoxon nonparametric statistical analysis (p < .05), significant and relevant indicators of resolution being found in the process of occupational choice. This technical resource was shown, from this empirical evidence, to be promising for use in evaluation of intervention processes of Vocational Guidance.
Resumo:
Understanding the role of multiple colour signals during sexual signalling is a central theme in animal communication. We quantified the role of multiple colour signals (including ultraviolet, UV), measures of body size and testosterone levels in settling disputes between male rivals in an elaborately ornamented, African lizard, played out in a large 'tournament' in the wild. The hue and brightness (total reflectance) of the UV throat in Augrabies flat lizards, Platysaurus broadleyi, as well as body size, were consistent and strong predictors of 'fighting ability'. Males with high fighting ability were larger and displayed a UV throat with low total reflectance. In contrast, males with low fighting ability were smaller and had violet throats with broader spectral reflectance curves (higher total reflectance). As fighting ability is associated with alternative reproductive tactics in this system (territorial versus floater), we also examined the role of colour signals in predicting male reproductive tactic. Territorial males had UV throats with higher chroma but had poorer body condition than floater males, probably because of the energetic costs of maintaining a territory. Although testosterone was not a significant predictor of fighting ability or reproductive tactic, it was correlated with the hue of the UV throat, suggesting that testosterone may impose some constraint on signal expression. Lastly, we show that within the context of the natural signalling environment, UV-reflective throats constitute a conspicuous, effective signal that male Augrabies flat lizards use to advertise their status honestly to rivals. (c) 2006 The Association for the Study of Animal Behaviour. Published by Elsevier Ltd. All rights reserved.
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
Resumo:
The movement towards evidence-based practice in psychology and medicine should offer few problems in cognitive-behaviour therapies because it is consistent with the principles by which they have been developed and disseminated. However, the criteria for assessing empirical status, including the heavy emphasis on manualised treatments, need close examination. A possible outcome of the evidence-based movement would be to focus on the application of manualised treatments in both training and clinical practice; problems with that approach are discussed. If we are committed to evidence-based treatment, comparisons between psychological and pharmacological interventions should also be included so that rational health care decisions can be made. We should not be afraid of following the evidence, even when it supports treatments that are not cognitive-behavioural in stated orientation. Such results should be taken as an opportunity for theoretical development and new empirical inquiry rather than be a cause for concern.
Resumo:
Introduction. Previous research has demonstrated that sildenafil citrate users alter dosing-sexual attempt behavior when switched to tadalafil. The impact of geography and culture on sexual behavior with phosphodiesterase type 5 (PDE5) inhibitor treatment has not been fully investigated. Aim. To describe and compare the changes in dosing-sexual attempt behavior with sildenafil citrate vs. tadalafil treatment across four distinct geographies: Asia, Australia/New Zealand (ANZ), Central Eastern Europe/Middle East (CEE/ME), and Latin America (LA). Methods. Data from a single-arm, open-label clinical trial conducted in 21 countries from November 2002 to May 2004 were used in this analysis. Men with erectile dysfunction and a history of >= 6-week prior sildenafil citrate use continued sildenafil citrate treatment for 4 weeks then switched to tadalafil for 8 weeks. Dosing instructions were provided. Main Outcomes Measures. Timing of dose and sexual intercourse was assessed through patient diaries for the final 4 weeks of each treatment period. Results. A total of 2,760 men were enrolled: Asia 15.8%; ANZ 29.4%; CEE/ME 19.7%; LA 35.1%. The median time from dosing to intercourse was significantly increased during tadalafil treatment across all geographical regions; however, the magnitude of increase differed significantly by geography (P < 0.0001). The Asian cohort demonstrated the shortest duration between dosing and sexual intercourse attempts (irrespective of drug), and altered sexual behavior the least upon switching to tadalafil. The ANZ cohort demonstrated the longest duration between dosing and sexual intercourse attempts (irrespective of drug), and altered sexual behavior the most upon switching to tadalafil. Conclusion. Men with a history of established sildenafil citrate use alter their dose-attempt behavior when treated with tadalafil irrespective of geography. However, the extent to which sexual behavior alters is not uniform across geographical regions, suggesting that dosing instructions and duration of drug effectiveness, in combination with personal and cultural preferences, may determine sexual behavior with PDE5 inhibitor use. Rubio-Aurioles E, Glina S, Abdo CHN, Hernandez-Serrano R, Rampazzo C, Sotomayor M, West TM, Gallagher GL, and Lenero E. Timing of dose relative to sexual intercourse attempt in previous sildenafil citrate users treated with tadalafil: A geographical comparison from a single arm, open-label study. J Sex Med 2009;6:2836-2850.
Resumo:
In this paper we present a new neuroeconomics model for decision-making applied to the Attention-Deficit/Hyperactivity Disorder (ADHD). The model is based on the hypothesis that decision-making is dependent on the evaluation of expected rewards and risks assessed simultaneously in two decision spaces: the personal (PDS) and the interpersonal emotional spaces (IDS). Motivation to act is triggered by necessities identified in PDS or IDS. The adequacy of an action in fulfilling a given necessity is assumed to be dependent on the expected reward and risk evaluated in the decision spaces. Conflict generated by expected reward and risk influences the easiness (cognitive effort) and the future perspective of the decision-making. Finally, the willingness (not) to act is proposed to be a function of the expected reward (or risk), adequacy, easiness and future perspective. The two most frequent clinical forms are ADHD hyperactive (AD/HDhyp) and ADHD inattentive (AD/HDdin). AD/HDhyp behavior is hypothesized to be a consequence of experiencing high rewarding expectancies for short periods of time, low risk evaluation, and short future perspective for decision-making. AD/HDin is hypothesized to be a consequence of experiencing high rewarding expectancies for long periods of time, low risk evaluation, and long future perspective for decision-making.
Resumo:
Dopamine agonists are the treatment of choice for prolactinomas. However, there are still controversies concerning dose, treatment duration and criteria for drug withdrawal in different clinical situations. The aim of this study was to assess diagnostic and therapeutic approaches to prolactinomas among members of the Brazilian Society of Endocrinology and Metabolism (SBEM). SBEM members answered a questionnaire sent by e-mail that included 18 questions related to controversial issues about the management of prolactinomas. Among SBEM members, 721 (approximately 24% of total) answered the questionnaire. Concerning the diagnosis, 38% of the respondents stated that prolactin levels < 100 ng/ml would exclude the presence of a prolactinoma. Most of them favored the screening for macroprolactin in asymptomatic individuals instead of a routine screening (74% vs. 26%). Regarding the treatment, 70% of the respondents chose cabergoline as the drug of choice to treat macroprolactinomas whereas similar proportions advised cabergoline or bromocriptine as the best treatment for microprolactinomas (52% vs. 48%). Only 20% and 34% of respondents favored treatment withdrawal 2-3 years after prolactin normalization in patients with macroprolactinomas and microprolactinomas, respectively. In case of pregnancy, only 58 and 70% of respondents advocated discontinuation of treatment with dopamine agonists in patients with macroprolactinomas and microprolactinomas, respectively. Finally, only 36% would allow breast-feeding without restriction, 44% would restrict it to patients with microprolactinomas and 20% would not recommend it for women with prolactinomas There are several points of disagreement among SBEM members regarding the management of prolactinomas.
Resumo:
To determine whether peer-reviewed consensus statements have changed clinical practice, we surveyed acromegaly care in specialist centers across the globe, and determined the degree of adherence to published consensus guidelines on acromegaly management. Sixty-five acromegaly experts who participated in the 7th Acromegaly Consensus Workshop in March 2009 responded. Results indicated that the most common referring sources for acromegaly patients were other endocrinologists (in 26% of centers), neurosurgeons (25%) and primary care physicians (21%). In sixty-nine percent of patients, biochemical diagnoses were made by evaluating results of a combination of growth hormone (GH) nadir/basal GH and elevated insulin like growth factor-I (IGF-I) levels. In both Europe and the USA, neurosurgery was the treatment of choice for GH-secreting microadenomas and for macroadenomas with compromised visual function. The most widely used criteria for neurosurgical outcome assessment were combined measurements of IGF-I and GH levels after oral glucose tolerance test (OGTT) 3 months after surgery. Ninety-eight percent of respondents stated that primary treatment with somatostatin receptor ligands (SRLs) was indicated at least sometime during the management of acromegaly patients. In nearly all centers (96%), the use of pegvisomant monotherapy was restricted to patients who had failed to achieve biochemical control with SRL therapy. The observation that most centers followed consensus statement recommendations encourages the future utility of these workshops aimed to create uniform management standards for acromegaly.
Resumo:
Here we investigated the possible association between the carboxypeptidase A (CPA)-like activity of the rat mesenteric arterial bed (MAB) perfusate and the ability of this fluid of forming angiotensin (Ang) 1-9 and Ang 1-7 upon incubation with Ang I and Ang II, respectively. Initially, we observed that anion exchange chromatography of the perfusate would consistently split the characteristic Z-Val-Phe-hydrolyzing activity of CPA-like enzymes into five distinct peaks, whose proteolytic activities were then determined using also Ang I and Ang II as substrates. The resulting proteolytic profile for each peak indicated that rat MAB perfusate contains a complex mixture of carboxypeptidases; tentatively, five carboxypeptidases were distinguished based on their substrate preferences toward Z-Val-Phe. Ang I and Ang II. The respective reactions, namely, Z-Val-Phe cleavage, Ang I to Ang 1-9 conversion and Ang II to Ang 1-7 conversion, were inhibited by 1,10-phenanthroline and nearly fully blocked by potato carboxypeptidase inhibitor. Also, all the CPA-like activity peaks prepared by anion exchange chromatography were tested negative for contaminating Ang I-converting enzyme-2, cathepsin A and prolylcarboxypeptidase. Overall, our results indicate that rat MAB perfusate contains a multiplicity of Ang I and Ang II-processing CPA-like enzymes whose proteolytic specificities suggest they might perform peculiar regulatory roles in the local resin-angiotensin system. (C) 2008 Elsevier B.V. All rights reserved.
Resumo:
Purpose: The effects of anxiety on the patient and his/her family are known to be the main factors that influence health recovery in child surgery. When the whole family can be prepared and supported by psychologic intervention, the damage to child behavior and family anxiety is attenuated. Methods: This study was conducted in children between 2 and 6 years old, divided into 2 groups of 10 pairs each. The experimental group received psychologic intervention, whereas the control group did not. One month after the surgery, they were reevaluated and compared with the same instruments used in the beginning of the study. The instruments used were as follows: the State-Trait Anxiety Inventory with the mothers and the Rutter`s Child Behavior A2 Scale and the Posthospital Behavior Questionnaire with the children. Results: The results were compared by the Wilcoxon and Mann-Whitney nonparametric tests for independent samples, both at the P <.05 significance levels. Mothers stated that anxiety was different in the postsurgery period, showing a significant decrease when comparing the experimental and control groups. Both instruments to measure child behavior also showed that prepared children had less habit changes than the control group, which showed increased levels of inadequate behavior. Conclusions: These data confirm reports in literature regarding child preparation before medical intervention and reinforces the importance of specialized presurgery planning procedures by the proper professional interfaced with the surgical colleagues, all aiming toward the best recovery for the children. (C) 2009 Elsevier Inc. All rights reserved.
Resumo:
The main objective of this experiment is to determine the amount of nicotine in commercial brand cigarettes by means of a nonaqueous acid-base titration. A simple glass device simulating a smoker is proposed, which allows the determination of the volatilized, filter retained, and inhaled portions. Students will readily see that the amount of nicotine/cigarette stated on the label (similar to 0.5-1.0 mg) refers indeed to the inhaled portion only, rather than to the total amount/cigarette (usually more than 10 mg). Even so, values for inhaled nicotine may be significantly higher than those reported for several brands. Students will also be able to make a critical evaluation of the true content of nicotine in the inhaled portion and confront it with the reported value for a given brand. In addition, the theoretical approach, supported by HPLC data, provides an excellent experience on nonaqueous acid-base volumetric analysis.
Resumo:
After providing some brief background on Dendrolagus species in Australia, two consecutive surveys of Brisbane’s residents are used to assess public knowledge of tree-kangaroos and the stated degree of support for their conservation in Australia. The responses of participants in Survey I are based on their pre-survey knowledge of wildlife. The same additional set of participants completed Survey II after being provided with information on all the wildlife species mentioned in Survey I. Changes in the attitudes of respondents and their degree of support for the protection and conservation of Australia’s tree-kangaroos are measured, including changes in their contingent valuations and stated willingness to provide financial support for such conservation. Reasons for wanting to protect tree-kangaroos are specified and analyzed. Furthermore, changes that occur in the relative importance of these reasons with increased knowledge are also examined. Support for the conservation of tree-kangaroos is found to increase with the additional knowledge supplied. Furthermore, support for the conservation of Australia’s less well-known tropical mammals is shown to increase relative to better known mammals (icons) present in temperate areas, such as koalas and red kangaroos with this increased knowledge. Possible implications of the results for government conservation policies in Australia are examined.
Resumo:
After introducing the importance of the topic, we examine the economic impacts of wildlife tourism on income and employment as an indicator of the importance of this form of tourism. While such indicators can be important politically and to particular interest groups, they are shown to be an inadequate guide to the economic use and conservation of resources, including wildlife used in tourism. One reason for this (amongst others) is that total economic value must be taken into account in determining economic resource use and this is shown to be quite important in the case of wildlife species. Empirical procedures, such as use of the travel cost method and stated preference methods (for example, contingent valuation) are outlined and the way in which they can be used for determining the optimal economic allocation of land and other resources for wildlife tourism is explained. Economic implications and limitations of some empirical estimates of the importance of wildlife tourism are discussed. This leads on to a consideration of the purpose and usefulness of using economic instruments to manage wildlife tourism.
Resumo:
The number of people aged 65 years or over in low-income rental households will more than double by 2026. The social housing system, at its current growth rate, will not meet their needs. This research involved demographic projections of older renters, examined their housing preferences, and analysed the supply capacity of the public and private rental sectors to respond.