Florivory and sex ratio in Annona dioica St. Hil. (Annonaceae) in the Pantanal at Nhecolândia, southwestern Brazil

Annona dioica St. Hil. is a species that grows to approximately 2 m tall and is very widespread in the cerrados. Individual plants of this androdioecious species produce numerous hermaphroditic or male flowers, but few fruits. The aim of this study was to determine the sex ratio among the plants and to compare the frequency of herbivory between male and hermaphroditic flowers. The fieldwork was done by studying flowering plants in grasslands used as pasture for cattle at Fazenda Nhumirim. One hundred and forty-seven male plants and 71 hermaphroditic plants were examined and produced a total of 194 and 94 flowers, respectively, during the study period. The male:hermaphrodite sex ratio was 2.07:1, and was similar to the male:hermaphrodite flower ratio of 2.06:1. The frequency of florivory rate in hermaphrodites was significantly higher than in male flowers (33.0%, n = 31, and 25.7%, n = 50, respectively; G = 14.83; d.f. = 1; p < 0.001). The mean fresh weights of male and hermaphroditic flowers were significantly different (8.38 ± 2.40 g vs. 6.93 ± 2.68 g, respectively; 0 ± SEM; n = 50 each; t = 2.479; d.f. = 49; p = 0.017). These results indicate that the low fruit set in this species can be explained by the sex ratio, the greater herbivory of hermaphroditic flowers and the probable absence of pollinators.

Aspectos ultra-estruturais dos canais secretores em órgãos vegetativos e reprodutivos de Anacardiaceae

The study assessed phloem canal development and ultra-structure in shoot apices of Spondias dulcis G. Forst., phloematic canal ultra-structure in shoot apices of Tapirira guianensis Aubl., and floral canal ultra-structure and development and fruit canal ultra-structure of the latter specie. The flower and fruit canals of Anacardium humile St.Hil. were also studied ultra-structurally. The canals in shoot apices of S. dulcis show schizo-lysigenous formation and the floral canals of T. guianensis show schizogenous development. Epithelial cells of S. dulcis and T. guianensis canals have rough endoplasmic reticulum, free ribosomes, elongated plastids of several shapes with osmiophilic inclusions and dictyosomes with production of vesicles. Such organelles participate in the secretion of a heterogeneous exudate, which is comprised of hydrophilic and lipophilic substances. The epithelial cells of the fruit of A. humile present elongated plastids with circular membrane system, which are involved in the synthesis of lipophilic substances. The results of the ultra-structural analyses of the epithelial cells corroborate the results previously obtained in a histochemical study. In the histochemical study, lipophilic and hydrophilic substances were identified in the canals of T. guinanensis and S. dulcis and only lipophilic substances were identified in the canals of A. humile. Based on the ultrastructural aspects of the secretory canals of T. guianensis and S. dulcis we concluded that the plastids of the epithelial cells of the two species are different although they produce secretion of similar composition. A new record for the family is the presence of a great number of circular plastids in epithelial cells of the fruit of Anacardium humile. The pattern found in the secretory canals of the studied species is the ecrine type of secretion release.

Compreensão da sexualidade por jovens com diagnóstico de deficiência intelectual

The study describes the comprehension of concepts about sexuality by youths diagnosed with intellectual deficiency, during classes on sexual education. The analysis of selected episodes from video transcriptions of five classes (Human Body, Kiss, Flirting, Coitus, Condom/STD) showed: the appropriation and understanding of concepts, partial difficulties of comprehension, and inhibition. The analysis of the transcripts indicated that all students were attentive to the classes, participated in the proposed tasks, and answered the questions. The observed signs of inhibition and the expression of values were similar to those observed in other youngsters, indicating the appropriation of culturally established values. The obtained evidences contrast with mythical visions related to sexuality in these youngsters, and suggest more studies about their competences.

Formas de Funcionalismo na Sintaxe

This article shows that the term functionalism, very often understood as a single or uniform approach in linguistics, has to be understood in its different perspectives. I start by presenting an opposing conception similar to the I-language vs E-language in Chomsky (1986). As in the latter conception , language can be understood as an abstract model of a mind internal mechanism responsible for language production and perception or, as in the former one, it can be the description of the external use of language. Also like with formalists , there are functionalists who look for cross-linguistic variation (and universals of language use) and functionalists who look for language internal variation. It is also shown that functionalists can differ in the extent to which social variables are considered in the explanation of linguistic form.

Uma observação sobre o lugar da teoria da ligação e do critério temático dentro do programa minimalista

In this paper I present some evidencie that forces us to conclude that within the Minimalist Program (Chomsky 1993; 1995), Binding Theory (BT) should be computed after LF (Logical Form). I show that derivations leading to structures containing violations of BT-Principles must converge at LF, since less economical alternative derivations respecting those principles are also ungrammatical. Being irrelevant to the notion of convergence, BT must apply after LF. A similar reasoning reveals that the Theta-Criterion should have the status of a bare output condition appling at LF, since less economical derivations are allowed by the computational system to prevent violations of it.

Variação sazonal da fotossíntese, condutância estomática e potencial da água na folha de laranjeira 'Valência'

Seasonal variation in environmental conditions may influence gas exchange rates as well as water relations in perennial species. This work was carried out to evaluate photosynthetic rates (A), transpiration (E), stomatal conductance (g) and leaf water potential (psi f ) in 'Valencia' orange trees grafted on four different rootstocks. Measurements were made twice a day: from 9h00 to 11h00 a.m. and from 1h00 to 3h00 p.m., during January, March and July. A and g were significantly lower and psif was significantly more negative, in the afternoon. The decrease in A may be related to the reduction in g, due to the increase in the vapor pressure deficit between the air and the leaf (VPDair-leaf ) in the afternoon, when temperatures are higher. In spite of the partial stomatal closure in the afternoon, the values for E were approximately the same as those measured in the morning, due to the increase in the VPDair-leaf . A decrease in A and g could also be noted from January to July, that is, from the hot and humid summer months, to the colder and drier winter ones. It was suggested that the decrease in A and g observed from January through March, may be related to the decrease in plant growth rates, which could have influenced the source-sink relationships, since the climatic conditions for both months were similar. The decrease in A and g showed in July, seems to be related to the decrease in both the night temperature and the growth rate of plants.

Epidemiologia da insônia

A vast literature review on the insomnia epidemiology, the most common sleep disorder, using MEDLINE and LILACS last 30 years of data, was performed from January 2002 to November 2003. The key-words were: sleep initiation disorders, sleep maintenance disorders, early awakening disorder, insomnia, sleep disorders, insomnia prevalence, insomnia consequences. Several insomnia definition criteria and epidemiology researches methods, with data comparison difficulties, were noticed. In the future it will be necessary similar insomnia definition and epidemiology studies criteria.

Efeito cariostático de restaurações adesivas em superfícies radiculares: estudo in vitro

Dental materials that release fluoride have been shown to be effective in caries inhibition around restorations. Adhesive materials would also be effective in caries inhibition by sealing and protecting cavity margins from acidic demineralization. This in vitro study tested the hypothesis that composite restorations with a dentin adhesive system have a caries preventive effect similar to that of an adhesive material with fluoride - glass-ionomer cement - on root surfaces. Twenty roots from extracted sound third molars were embedded in polystyrene resin and ground flat. Standardized cavities were prepared in leveled root surfaces and randomly restored with (a) Chelon-Fil (Espe) or (b) Z100/SingleBond (3M). Baseline indentations were measured at 100, 200 and 300 mum from the occlusal margins of each restoration and the surface microhardness values were obtained using a Knoop diamond indenter. A 2.0 mm wide margin around the restorations was submitted to a pH-cycling model, at 37ºC. After that, surface microhardness was measured again, as it was before. The differences between baseline and final surface microhardness were considered for statistical analysis. The median values of differences were (a): -3.8; -0.3; -1.0; and (b): 3.3; 2.5; 1.7, for the distances of 100, 200 and 300 mum, respectively. The Kruskal-Wallis test did not show statistically significant difference between 100, 200 and 300 mum distances in each tested group. There was no difference between the studied materials at the distances of 200 and 300 mum. Chelon-Fil was statistically different from Z100/SingleBond, at 100 mum (p<0.05). Under the studied conditions, the glass-ionomer cement had a higher caries preventive effect than the composite/dentin adhesive restorations.

Alteração dimensional linear de resinas para bases de próteses polimerizadas com microondas

This study examined the influence of three polymerization cycles (1: heat cure - long cycle; 2: heat cure - short cycle; and 3: microwave activation) on the linear dimensions of three denture base resins, immediately after deflasking, and 30 days after storage in distilled water at 37± 2ºC. The acrylic resins used were: Clássico, Lucitone 550 and Acron MC. The first two resins were submitted to all three polymerization cycles, and the Acron MC resin was cured by microwave activation only. The samples had three marks, and dimensions of 65 mm in length, 10 mm in width and 3 mm in thickness. Twenty-one test specimens were fabricated for each combination of resin and cure cycle, and they were submitted to three linear dimensional evaluations for two positions (A and B). The changes were evaluated using a microscope. The results indicated that all acrylic resins, regardless of the cure cycle, showed increased linear dimension after 30 days of storage in water. The composition of the acrylic resin affected the results more than the cure cycles, and the conventional acrylic resin (Lucitone 550 and Clássico) cured by microwave activation presented similar results when compared with the resin specific for microwave activation.

Microencapsulação de óleo essencial de laranja

It was done microencapsulation of natural essencial orange oil through spray-drying. The purpose was to use the best proportion of wall materials among maltodextrin, acacia gum, and modified starch (capsul) in order to retain greater amount of orange oil. The orange oil (10%) and maltodextrin (36%) remained constant. Three spray drying temperatures were employed: 180°C, 200°C and 220°C, therefore, nine final products were obtained. The superficial and inner oil concentrations were measured. The microcapsules were also examined through optical and scanning electron microscopy. The three temperatures employed did not affect the microencapsulation. The microstructure of the capsules were almost similar regardless the proportion employed among the carbohydrates to wall composition. At light microscopy it was observed a great heterogeneity of capsules diameters, and probably not smooth surfaces; at scanning electron microscopy it was clear that the walls displayed porosity over round surfaces. The best retention was given by the formula containing 10% of capsul, 10% of orange oil and 36% of maltodextrin, when total oil retention was 94%, regardless the drying temperature here employed.

COMPARAÇÃO DAS PROPRIEDADES REOLÓGICAS DA MASSA DE CACAU TORRADA CONVENCIONALMENTE E POR MICROONDAS

Two kinds of roasting cocoa system: conventional batch method in electrical oven, and by microwaves, in a continuous microwave rotary applicator (2450MHz), were compared with respect to viscosity. Cocoa was roasted in whole beans and in nibs. The variable used in the microwave treatment was the power density applied to the whole beans (254,45 to 290,80 Wh/kg) and to the nibs (227,27 to 262,23 Wh/kg), with a constant holding time of 10 minutes. The variable used in the conventional roasting process was the roasting time of the beans (40 to 44 min) and the nibs (34 to 38 min), with constant temperature in the jacket of electric oven (150°C). Viscosity was measured in a Brookfield rheometer (mod RV-DVIII) at 40°C. In general, the plastic viscosity of the microwaved samples was lower than that of the conventional roasted samples. Also the nibs showed lower viscosities than the whole beans when roasted in the electric oven. The viscosity of the samples roasted in the microwave oven was lower in the whole beans than in the nibs. The product was sensorially evaluated by three experts in cocoa flavour, and it was shown that the flavour of the microwave roasted products was similar to that of the conventionally roasted products, with the advantage of a reduction in process time.

Avaliação do amaciamento de carne bovina de dianteiro (Triceps brachii) pelos métodos de maturação, estimulação elétrica, injeção de ácidos e tenderização mecânica

Twenty-two Triceps brachii muscle obtained from 11 cows aged 3 and 4 years , killed in an experimental slaughter plant, were submitted to mechanical tenderization, injection with acetic acid 0,1M and lactic acid 0,2M, ageing for 9 and 14 days and electrical stimulation (250v - 60Hz - 90s), some of them were reserved as a control group, without treatment. The 14 days ageing time presented 21% of increase in subjective tenderness and 12% of reduction in shear force, these values were similar to the electrical stimulated meat. However the injection with acids and the ageing time 9 days did not present significant effect in the texture. Although the shear force values of mechanical tenderized meat was the shortest among all treatments, suspect of superestimation because of the fractures plan created by this process. Another analyses were carried out: pH reduction curve, R value; colour analysis; weight losses by cooking and by treatment; and microbiological analysis.

Féculas fermentadas na fabricação de biscoitos: estudo de fontes alternativas

The fermented cassava starch has been used as raw material for many products of the Brazilian culinary mainly in the biscuit manufacturing. Starch of arrowroot, english potato, baroa-potato and cassava were extracted and fermented in order to investigate other fermented starch sources for manufacturing biscuits. The fermented starch showed characteristics similar to those of commercial fermented cassava starch. The biscuits manufactured from the fermented starch of english potato didn?t expand and was very hard and the biscuits manufactured from the fermented starch of arrowroot and of baroa-potato were approved by the consumers and can be used in the biscuit manufacturing the same way as the fermented cassava starch.

Desidratação osmótica de abacaxi aplicada à tecnologia de métodos combinados

The aim of this research was to optimize osmotic dehydration of pineapple, according to two criteria: maximize water loss and minimize solid gain. The process was made as an application to Combined Methods Technology, in which three preservation factors were combined: water activity, pH and chemical preservatives, all being applied at low levels, in order to get a product resembling non-processed fruit. The experiment was divided into three treatments, being: non-coated pineapple pieces (A), pieces coated with alginate (B) and coated with low-methoxyl pectin (C). Process involved the following main steps: enzymatic inactivation of fruit pieces; in treatments B and C, incorporation of their respective coatings; and osmotic dehydration, in sucrose syrup containing potassium sorbate and citric acid. Optimum conditions, determined from Response Surface Methodology, were the following: dehydration of fruit pieces coated by alginate, at 42-47° C, in sucrose syrup at 66-69° Brix, for 220 to 270 minutes. Results indicated that both coatings significantly affected the mass transfers of the process, reducing solid incorporation and increasing water loss; therefore, increasing weight loss and performance ratio (water loss: solid incorporation) took place. Water activity was not significantly affected by the coatings. The product obtained under optimum conditions was submitted to sensorial evaluation, and presented a good general acceptance. Moulds and yeasts countings indicated good microbiological stability of the product for at least 60 days at 30ºC.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.