Selective and Specific Activation of Rab5 during Endocytosis of Receptor Tyrosine Kinases

The Rab family of proteins are low molecular weight GTPases that have the ability to switch between GTP- (active) and GDP- (inactive) bound form, and in that sense act as molecular switches. Through distinct localization on various vesicles and organelles and by cycling through GTP/GDP bound forms, Rabs are able to recruit and activate numerous effector proteins, both spatially and temporally, and hence behave as key regulators of trafficking in both endocytic and biosynhtetic pathways. The Rab5 protein has been shown to regulate transport from plasma membrane to the early endosome as well as activate signaling pathways from the early endosome. This dissertation focused on understanding Rab5 activation via endocytosis of receptor tyrosine kinases (RTKs). First, tyrosine kinase activity of RTKs was linked to endosome fusion by demonstrating that tyrosine kinase inhibitors block endosome fusion and activation of Rab5, and a constitutively active form of Rab5 is able to rescue endosome fusion. However, depending on how much ligand is available at the cell surface, the receptor-ligand complexes can be internalized via a number of distinct pathways. Similarly, Rab5 was activated in a ligand-dependent concentration dependent manner via clathrin- and caveolin-mediated pathways, as well as a pathway independent of both. However, overexpression Rabex-5, a nucleotide exchange factor for Rab5, is able to rescue activation even when all of the pathways of EGF-receptor internalization were blocked. Next, the three naturally occurring splice variants of Rabex-5 selectively activated Rab5. Lastly, Rabex-5 inhibits differentiation of 3T3-L1 and PC12 cells through 1) degradation of signaling endosome via Rab5-dependent fusion with the early endosome, 2) and inhibition of signaling cascade via ubiquitination of Ras through the ZnF domain at the N-terminus of Rabex-5. In conclusion, these data shed light on complexity of the endosomal trafficking system where tyrosine kinase activity of the receptor is able to affect endosome fusion; how different endocytic pathways affect activation of one of the key regulators of early endocytic events; and how selective activation of Rab5 via Rabex-5 can control adipogenesis and neurogenesis.

Science of retracted science: a citation analysis of the arts and humanities domain

In the scholarly publishing domain, a retraction is raised when a specific publication is considered erroneous by the venue in which it appeared after it was published. The aim of this work is uncovering new insights and learn new important information to help us understand the retraction phenomenon in the arts and humanities domain. Our investigation is based on a methodology defined using quantitative and qualitative measures derived from previous studies in the transdisciplinary research field of “science of science” (SciSci). The designed methodology takes into account a general case of retraction and applies a citation analysis based on five phases. Citations to retracted publications (before and after their retraction) are gathered and characterized with a set of attributes, including general metadata and information extracted from citing entities’ full text. The annotated characteristics are further considered for a statistical and a textual analysis (i.e., a topic modeling analysis). The contribution of this thesis is grounded by addressing the following research questions: (RQ1) How did scholarly research cite retracted humanities publications before and after their retraction? (RQ2) Did all the humanities areas behave similarly concerning the retraction phenomenon? (RQ3) What are the main differences and similarities in the retraction dynamics between the humanities domain and the STEM disciplines? RQ1 and RQ2 are addressed by tuning and applying the methodology on the analysis of the retracted publications in the humanities domain. RQ3 is addressed on two levels, i.e., considering and comparing: (L1) the outcomes of the past studies on the retraction in STEM, and (L2) the results obtained from an analysis of a retraction case in STEM using the defined methodology.

Direct Visualization Of The Action Of Triton X-100 On Giant Vesicles Of Erythrocyte Membrane Lipids.

The raft hypothesis proposes that microdomains enriched in sphingolipids, cholesterol, and specific proteins are transiently formed to accomplish important cellular tasks. Equivocally, detergent-resistant membranes were initially assumed to be identical to membrane rafts, because of similarities between their compositions. In fact, the impact of detergents in membrane organization is still controversial. Here, we use phase contrast and fluorescence microscopy to observe giant unilamellar vesicles (GUVs) made of erythrocyte membrane lipids (erythro-GUVs) when exposed to the detergent Triton X-100 (TX-100). We clearly show that TX-100 has a restructuring action on biomembranes. Contact with TX-100 readily induces domain formation on the previously homogeneous membrane of erythro-GUVs at physiological and room temperatures. The shape and dynamics of the formed domains point to liquid-ordered/liquid-disordered (Lo/Ld) phase separation, typically found in raft-like ternary lipid mixtures. The Ld domains are then separated from the original vesicle and completely solubilized by TX-100. The insoluble vesicle left, in the Lo phase, represents around 2/3 of the original vesicle surface at room temperature and decreases to almost 1/2 at physiological temperature. This chain of events could be entirely reproduced with biomimetic GUVs of a simple ternary lipid mixture, 2:1:2 POPC/SM/chol (phosphatidylcholine/sphyngomyelin/cholesterol), showing that this behavior will arise because of fundamental physicochemical properties of simple lipid mixtures. This work provides direct visualization of TX-100-induced domain formation followed by selective (Ld phase) solubilization in a model system with a complex biological lipid composition.

[the Use Of Fish On Buccal Smear To Investigate Mosaicism With A 45,x Cell Line: Study On Healthy Men And Patients With Disorders Of Sex Development].

To verify whether fluorescence in situ hybridization (FISH) of cells from the buccal epithelium could be employed to detect cryptomosaicism with a 45,X lineage in 46,XY patients. Samples of nineteen 46,XY healthy young men and five patients with disorders of sex development (DSD), four 45,X/46,XY and one 46,XY were used. FISH analysis with X and Y specific probes on interphase nuclei from blood lymphocytes and buccal epithelium were analyzed to investigate the proportion of nuclei containing only the signal of the X chromosome. The frequency of nuclei containing only the X signal in the two tissues of healthy men did not differ (p = 0.69). In all patients with DSD this frequency was significantly higher, and there was no difference between the two tissues (p = 0.38), either. Investigation of mosaicism with a 45,X cell line in patients with 46,XY DSD or sterility can be done by FISH directly using cells from the buccal epithelium.

The Effect Of Celastrol, A Triterpene With Antitumorigenic Activity, On Conformational And Functional Aspects Of The Human 90kda Heat Shock Protein Hsp90α, A Chaperone Implicated In The Stabilization Of The Tumor Phenotype.

Hsp90 is a molecular chaperone essential for cell viability in eukaryotes that is associated with the maturation of proteins involved in important cell functions and implicated in the stabilization of the tumor phenotype of various cancers, making this chaperone a notably interesting therapeutic target. Celastrol is a plant-derived pentacyclic triterpenoid compound with potent antioxidant, anti-inflammatory and anticancer activities; however, celastrol's action mode is still elusive. In this work, we investigated the effect of celastrol on the conformational and functional aspects of Hsp90α. Interestingly, celastrol appeared to target Hsp90α directly as the compound induced the oligomerization of the chaperone via the C-terminal domain as demonstrated by experiments using a deletion mutant. The nature of the oligomers was investigated by biophysical tools demonstrating that a two-fold excess of celastrol induced the formation of a decameric Hsp90α bound throughout the C-terminal domain. When bound, celastrol destabilized the C-terminal domain. Surprisingly, standard chaperone functional investigations demonstrated that neither the in vitro chaperone activity of protecting against aggregation nor the ability to bind a TPR co-chaperone, which binds to the C-terminus of Hsp90α, were affected by celastrol. Celastrol interferes with specific biological functions of Hsp90α. Our results suggest a model in which celastrol binds directly to the C-terminal domain of Hsp90α causing oligomerization. However, the ability to protect against protein aggregation (supported by our results) and to bind to TPR co-chaperones are not affected by celastrol. Therefore celastrol may act primarily by inducing specific oligomerization that affects some, but not all, of the functions of Hsp90α. To the best of our knowledge, this study is the first work to use multiple probes to investigate the effect that celastrol has on the stability and oligomerization of Hsp90α and on the binding of this chaperone to Tom70. This work provides a novel mechanism by which celastrol binds Hsp90α.

Site Specific Spin Dynamics In Bafe2as2: Tuning The Ground State By Orbital Differentiation.

The role of orbital differentiation on the emergence of superconductivity in the Fe-based superconductors remains an open question to the scientific community. In this investigation, we employ a suitable microscopic spin probe technique, namely Electron Spin Resonance (ESR), to investigate this issue on selected chemically substituted BaFe2As2 single crystals. As the spin-density wave (SDW) phase is suppressed, we observe a clear increase of the Fe 3d bands anisotropy along with their localization at the FeAs plane. Such an increase of the planar orbital content is interestingly independent of the chemical substitution responsible for suppressing the SDW phase. As a consequence, the magnetic fluctuations in combination with this particular symmetry of the Fe 3d bands are propitious ingredients for the emergence of superconductivity in this class of materials.

Applications Of Visual Evoked Potentials And Fourier-domain Optical Coherence Tomography In Parkinson's Disease: A Controlled Study.

The goal of this cross-sectional observational study was to quantify the pattern-shift visual evoked potentials (VEP) and the thickness as well as the volume of retinal layers using optical coherence tomography (OCT) across a cohort of Parkinson's disease (PD) patients and age-matched controls. Forty-three PD patients and 38 controls were enrolled. All participants underwent a detailed neurological and ophthalmologic evaluation. Idiopathic PD cases were included. Cases with glaucoma or increased intra-ocular pressure were excluded. Patients were assessed by VEP and high-resolution Fourier-domain OCT, which quantified the inner and outer thicknesses of the retinal layers. VEP latencies and the thicknesses of the retinal layers were the main outcome measures. The mean age, with standard deviation (SD), of the PD patients and controls were 63.1 (7.5) and 62.4 (7.2) years, respectively. The patients were predominantly in the initial Hoehn-Yahr (HY) disease stages (34.8% in stage 1 or 1.5, and 55.8 % in stage 2). The VEP latencies and the thicknesses as well as the volumes of the retinal inner and outer layers of the groups were similar. A negative correlation between the retinal thickness and the age was noted in both groups. The thickness of the retinal nerve fibre layer (RNFL) was 102.7 μm in PD patients vs. 104.2 μm in controls. The thicknesses of retinal layers, VEP, and RNFL of PD patients were similar to those of the controls. Despite the use of a representative cohort of PD patients and high-resolution OCT in this study, further studies are required to establish the validity of using OCT and VEP measurements as the anatomic and functional biomarkers for the evaluation of retinal and visual pathways in PD patients.

Survival Extrapolation In The Presence Of Cause Specific Hazards.

Health economic evaluations require estimates of expected survival from patients receiving different interventions, often over a lifetime. However, data on the patients of interest are typically only available for a much shorter follow-up time, from randomised trials or cohorts. Previous work showed how to use general population mortality to improve extrapolations of the short-term data, assuming a constant additive or multiplicative effect on the hazards for all-cause mortality for study patients relative to the general population. A more plausible assumption may be a constant effect on the hazard for the specific cause of death targeted by the treatments. To address this problem, we use independent parametric survival models for cause-specific mortality among the general population. Because causes of death are unobserved for the patients of interest, a polyhazard model is used to express their all-cause mortality as a sum of latent cause-specific hazards. Assuming proportional cause-specific hazards between the general and study populations then allows us to extrapolate mortality of the patients of interest to the long term. A Bayesian framework is used to jointly model all sources of data. By simulation, we show that ignoring cause-specific hazards leads to biased estimates of mean survival when the proportion of deaths due to the cause of interest changes through time. The methods are applied to an evaluation of implantable cardioverter defibrillators for the prevention of sudden cardiac death among patients with cardiac arrhythmia. After accounting for cause-specific mortality, substantial differences are seen in estimates of life years gained from implantable cardioverter defibrillators.

Effects Of Misalignments In The Retinal Nerve Fiber Layer Thickness Measurements With Spectral Domain Optical Coherence Tomography.

Purpose. To investigate misalignments (MAs) on retinal nerve fiber layer thickness (RNFLT) measurements obtained with Cirrus(©) SD-OCT. Methods. This was a retrospective, observational, cross-sectional study. Twenty-seven healthy and 29 glaucomatous eyes of 56 individuals with one normal exam and another showing MA were included. MAs were defined as an improper alignment of vertical vessels in the en face image. MAs were classified in complete MA (CMA) and partial MA (PMA), according to their site: 1 (superior, outside the measurement ring (MR)), 2 (superior, within MR), 3 (inferior, within MR), and 4 (inferior, outside MR). We compared RNFLT measurements of aligned versus misaligned exams in all 4 sectors, in the superior area (sectors 1 + 2), inferior area (sectors 3 + 4), and within the measurement ring (sectors 2 + 3). Results. RNFLT measurements at 12 clock-hour of eyes with MAs in the superior area (sectors 1 + 2) were significantly lower than those obtained in the same eyes without MAs (P = 0.043). No significant difference was found in other areas (sectors 1 + 2 + 3 + 4, sectors 3 + 4, and sectors 2 + 3). Conclusion. SD-OCT scans with superior MAs may present lower superior RNFLT measurements compared to aligned exams.

Post Hoc Analysis Of The Patricia Randomized Trial Of The Efficacy Of Human Papillomavirus Type 16 (hpv-16)/hpv-18 As04-adjuvanted Vaccine Against Incident And Persistent Infection With Nonvaccine Oncogenic Hpv Types Using An Alternative Multiplex Type-specific Pcr Assay For Hpv Dna.

The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).

Human Mitochondrial Hsp70 (mortalin): Shedding Light On Atpase Activity, Interaction With Adenosine Nucleotides, Solution Structure And Domain Organization.

The human mitochondrial Hsp70, also called mortalin, is of considerable importance for mitochondria biogenesis and the correct functioning of the cell machinery. In the mitochondrial matrix, mortalin acts in the importing and folding process of nucleus-encoded proteins. The in vivo deregulation of mortalin expression and/or function has been correlated with age-related diseases and certain cancers due to its interaction with the p53 protein. In spite of its critical biological roles, structural and functional studies on mortalin are limited by its insoluble recombinant production. This study provides the first report of the production of folded and soluble recombinant mortalin when co-expressed with the human Hsp70-escort protein 1, but it is still likely prone to self-association. The monomeric fraction of mortalin presented a slightly elongated shape and basal ATPase activity that is higher than that of its cytoplasmic counterpart Hsp70-1A, suggesting that it was obtained in the functional state. Through small angle X-ray scattering, we assessed the low-resolution structural model of monomeric mortalin that is characterized by an elongated shape. This model adequately accommodated high resolution structures of Hsp70 domains indicating its quality. We also observed that mortalin interacts with adenosine nucleotides with high affinity. Thermally induced unfolding experiments indicated that mortalin is formed by at least two domains and that the transition is sensitive to the presence of adenosine nucleotides and that this process is dependent on the presence of Mg2+ ions. Interestingly, the thermal-induced unfolding assays of mortalin suggested the presence of an aggregation/association event, which was not observed for human Hsp70-1A, and this finding may explain its natural tendency for in vivo aggregation. Our study may contribute to the structural understanding of mortalin as well as to contribute for its recombinant production for antitumor compound screenings.

Calibração da Reflectometria no Domínio do Tempo (TDR) para a estimativa da concentração da solução no solo

Time Domain Reflectometry (TDR) is a reliable method for in-situ measurements of the humidity and the solution concentration at the same soil volume. Accurate interpretation of electrical conductivity (and soil humidity) measurements may require a specific calibration curve. The primary goal of this work was to establish a calibration procedure for using TDR to estimate potassium nitrate concentrations (KNO3) in soil solution. An equation relating the electrical conductivity measured by TDR and KNO3 concentration was established enabling the use of TDR technique to estimate soil water content and nitrate concentration for efficient fertigation management.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Sensitivity and specificity of machine learning classifiers for glaucoma diagnosis using Spectral Domain OCT and standard automated perimetry

PURPOSE: To evaluate the sensitivity and specificity of machine learning classifiers (MLCs) for glaucoma diagnosis using Spectral Domain OCT (SD-OCT) and standard automated perimetry (SAP). METHODS: Observational cross-sectional study. Sixty two glaucoma patients and 48 healthy individuals were included. All patients underwent a complete ophthalmologic examination, achromatic standard automated perimetry (SAP) and retinal nerve fiber layer (RNFL) imaging with SD-OCT (Cirrus HD-OCT; Carl Zeiss Meditec Inc., Dublin, California). Receiver operating characteristic (ROC) curves were obtained for all SD-OCT parameters and global indices of SAP. Subsequently, the following MLCs were tested using parameters from the SD-OCT and SAP: Bagging (BAG), Naive-Bayes (NB), Multilayer Perceptron (MLP), Radial Basis Function (RBF), Random Forest (RAN), Ensemble Selection (ENS), Classification Tree (CTREE), Ada Boost M1(ADA),Support Vector Machine Linear (SVML) and Support Vector Machine Gaussian (SVMG). Areas under the receiver operating characteristic curves (aROC) obtained for isolated SAP and OCT parameters were compared with MLCs using OCT+SAP data. RESULTS: Combining OCT and SAP data, MLCs' aROCs varied from 0.777(CTREE) to 0.946 (RAN).The best OCT+SAP aROC obtained with RAN (0.946) was significantly larger the best single OCT parameter (p<0.05), but was not significantly different from the aROC obtained with the best single SAP parameter (p=0.19). CONCLUSION: Machine learning classifiers trained on OCT and SAP data can successfully discriminate between healthy and glaucomatous eyes. The combination of OCT and SAP measurements improved the diagnostic accuracy compared with OCT data alone.

Aplicação da escala de qualidade de vida em crianças de 07 a 12 anos praticantes de atividade fisica em academia e suas relações com a aptidão fisica

Universidade Estadual de Campinas . Faculdade de Educação Física