Biased Random-key Genetic Algorithms For The Winner Determination Problem In Combinatorial Auctions.

Abstract In this paper, we address the problem of picking a subset of bids in a general combinatorial auction so as to maximize the overall profit using the first-price model. This winner determination problem assumes that a single bidding round is held to determine both the winners and prices to be paid. We introduce six variants of biased random-key genetic algorithms for this problem. Three of them use a novel initialization technique that makes use of solutions of intermediate linear programming relaxations of an exact mixed integer-linear programming model as initial chromosomes of the population. An experimental evaluation compares the effectiveness of the proposed algorithms with the standard mixed linear integer programming formulation, a specialized exact algorithm, and the best-performing heuristics proposed for this problem. The proposed algorithms are competitive and offer strong results, mainly for large-scale auctions.

A Rosetta Stone For Nature's Benefits To People.

After a long incubation period, the Intergovernmental Platform on Biodiversity and Ecosystem Services (IPBES) is now underway. Underpinning all its activities is the IPBES Conceptual Framework (CF), a simplified model of the interactions between nature and people. Drawing on the legacy of previous large-scale environmental assessments, the CF goes further in explicitly embracing different disciplines and knowledge systems (including indigenous and local knowledge) in the co-construction of assessments of the state of the world's biodiversity and the benefits it provides to humans. The CF can be thought of as a kind of Rosetta Stone that highlights commonalities between diverse value sets and seeks to facilitate crossdisciplinary and crosscultural understanding. We argue that the CF will contribute to the increasing trend towards interdisciplinarity in understanding and managing the environment. Rather than displacing disciplinary science, however, we believe that the CF will provide new contexts of discovery and policy applications for it.

Tissue culture of Cecropia glaziovii Sneth (urticaceae): vegetative micropropagation and plant regeneration from callus

Cecropia glaziovii is a tree with used in Brazilian popular medicine. Methods allowing the clonal propagation of this species are of great interest for superior genotype multiplication and perpetuation. For this reason, we examined the effect of different culture media and different types of explants on adventitious shoot regeneration from callus and buds of C. glaziovii. Leaves, petioles and stipules obtained from aseptically grown seedlings or from pre-sterilized plants were used to initiate cultures. Adventitious shoot regeneration was achieved when apical and axillary buds were inoculated on gelled Murashige & Skoog (MS) medium supplemented with 6-benzylaminopurine alone (BAP) (1.0, 5.0 or 10.0 mg L-1) or combined with -naphthalene acetic acid (NAA) (1.0 or 2.0 mg L-1), after 40 days of culture. Best callus production was obtained after 30 days of petioles' culture on gelled MS medium with 2,4 dichlorophenoxyacetic acid (2,4-D) (5.0 mg L-1) combined with BAP (1.0 mg L-1). Successful shoot regeneration from callus was achieved when MS medium supplemented with zeatin (ZEA) (0.1 mg L-1) alone or combined with 2,4-D (1.0 or 5.0 mg L-1) was inoculated with friable callus obtained from petioles. All shoots were rooted by inoculation on MS medium supplemented with indole-3-acetic acid (IAA) (1.0 mg L-1). Rooted plants transferred to potting soil were successfully established. All in vitro regenerated plantlets showed to be normal, without morphological variations, being also identical to the source plant. Our study has shown that C. glaziovii can be propagated by tissue culture methods, allowing large scale multiplication of superior plants for pharmacological purposes.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Características sociodemográficas da mortalidade por câncer de boca em Bauru, SP, no período de 1991 a 2001: uso de geoprocessamento

O objetivo deste estudo foi avaliar as taxas de mortalidade por câncer de boca no período de 1991-2001, no município de Bauru-SP. A fonte de informação utilizada para o reconhecimento e seleção da população-alvo foram Certidões de Óbito dos Cartórios do município de Bauru com dados relativos ao período 1991-2001. Foram coletadas informações referentes a sexo, idade, localização da lesão e endereço. A coleta dos endereços visou à identificação no mapa do município de Bauru da localização geográfica do domicílio. Utilizando ferramentas do geoprocessamento, foi feita a inserção no mapa dos casos identificados. Foram registrados 67 casos de morte por câncer de boca na cidade de Bauru entre 1991 e 2001, com maiores taxas no sexo masculino e sexta década de vida. A análise da distribuição espacial mostra que a maioria dos casos encontra-se próxima à linha férrea que corta o município e foi responsável, em grande parte, pela ocupação territorial pela população, sendo esta também uma área que abrange os bairros mais antigos do município. O câncer de boca constitui importante causa de óbito no município, requerendo um planejamento de ações georreferenciadas pelo sistema local de saúde.

Convecção linearmente organizada na área de Petrolina, semi-árido do Nordeste do Brasil: aspectos em meso e grande escala

É apresentado um estudo sobre sistemas convectivos linearmente organizados e observados por um radar meteorológico banda-C na região semi-árida do Nordeste do Brasil. São analisados três dias (27 a 29) de março de 1985, com ênfase na investigação do papel desempenhado por fatores locais e de grande escala no desenvolvimento dos sistemas. No cenário de grande escala, a área de cobertura do radar foi influenciada por um cavado de ar superior austral no dia 27 e por um vórtice ciclônico de altos níveis no dia 29. A convergência de umidade próxima à superfície favoreceu a atividade convectiva nos dias 27 e 29, enquanto que divergência de umidade próxima à superfície inibiu a atividade convectiva no dia 28. No cenário de mesoescala, foi observado que o aquecimento diurno é um fator importante para a formação de células convectivas, somando-se a ele o papel determinante da orografia na localização dos ecos. De maneira geral, as imagens de radar mostram os sistemas convectivos linearmente organizados em áreas elevadas e núcleos convectivos intensos envolvidos por uma área de precipitação estratiforme. Os resultados indicam que convergência do fluxo de umidade em grande escala e aquecimento radiativo, são fatores determinantes na evolução e desenvolvimento dos ecos na área de estudo.

Time evolution of the South Atlantic Magnetic Anomaly

The South Atlantic Magnetic Anomaly (SAMA) is one of the most outstanding anomalies of the geomagnetic field. The SAMA secular variation was obtained and compared to the evolution of other anomalies using spherical harmonic field models for the 1590-2005 period. An analysis of data from four South American observatories shows how this large scale anomaly affected their measurements. Since SAMA is a low total field anomaly, the field was separated into its nondipolar, quadrupolar and octupolar parts. The time evolution of the non-dipole/total, quadrupolar/total and octupolar/total field ratios yielded increasingly high values for the South Atlantic since 1750. The SAMA evolution is compared to the evolution of other large scale surface geomagnetic features like the North and the South Pole and the Siberia High, and this comparison shows the intensity equilibrium between these anomalies in both hemispheres. The analysis of non-dipole fields in historical period suggests that SAMA is governed by (i) quadrupolar field for drift, and (ii) quadrupolar and octupolar fields for intensity and area of influence. Furthermore, our study reinforces the possibility that SAMA may be related to reverse fluxes in the outer core under the South Atlantic region.

Anomalous somatic embryos in Acca sellowiana (O. Berg) Burret (Myrtaceae)

Somatic embryogenesis represents a valuable tool for the studies on the basic aspects of plant embryo development. Today this process is used as a potencial technique for large-scale plant micropropagation although, so far, it has been applied to only a small number of species. However, when somatic embryos are malformed they are considered economically useless. In Acca sellowiana (O. Berg) Burret, an important fruit-producing crop, large amounts of anomalous somatic embryos (76.3%) were found just after 40 days of culture of explants in a 2,4-D containing medium. Among the anomalous forms found in the cotiledonary stage, 12.2% consisted of fused embryos, 40.4% displayed fused cotyledons, 13.0% presented supernumerary cotyledons, and 10.7% showed absence or poorly developed cotyledons, including those without the shoot apical meristem. Histological analyses indicated that the altered embryos were formed either directly from cotyledons, hypocotyl and radicle of the zygotic embryos used as explants, or indirectly from calli formed from these tissue parts. It is suggested that the formation of anomalous somatic embryos, as well as a low frequency of conversion into emblings reflect physiological and/or genetic disturbances triggered by the presence of 2,4-D in the medium. In vitro experimental alternative approaches are discussed in order to lessen the occurrence of malformed somatic embryos.

Non-coding RNAs in schistosomes: an unexplored world

Non-coding RNAs (ncRNAs) were recently given much higher attention due to technical advances in sequencing which expanded the characterization of transcriptomes in different organisms. ncRNAs have different lengths (22 nt to >1, 000 nt) and mechanisms of action that essentially comprise a sophisticated gene expression regulation network. Recent publication of schistosome genomes and transcriptomes has increased the description and characterization of a large number of parasite genes. Here we review the number of predicted genes and the coverage of genomic bases in face of the public ESTs dataset available, including a critical appraisal of the evidence and characterization of ncRNAs in schistosomes. We show expression data for ncRNAs in Schistosoma mansoni. We analyze three different microarray experiment datasets: (1) adult worms' large-scale expression measurements; (2) differentially expressed S. mansoni genes regulated by a human cytokine (TNF-α) in a parasite culture; and (3) a stage-specific expression of ncRNAs. All these data point to ncRNAs involved in different biological processes and physiological responses that suggest functionality of these new players in the parasite's biology. Exploring this world is a challenge for the scientists under a new molecular perspective of host-parasite interactions and parasite development.

Epilithic community development on artificial reefs deployed along a cross-shelf environmental gradient off Paraná state, southern Brazil

Concrete modules were deployed on the bottom of the 11, 18 and 30 meters isobaths along a cross-shelf hydrographic gradient off Paraná State, Southern Brazil, with the purpose of studying the colonization of sessile epilithic macroinvertebrates on artificial surfaces. After one year of submersion a total of 63 species of epilithic organisms were identified, dominated by Ostrea puelchana, Chthamalus bisinuatus, Balanus cf spongicola, Astrangia cf rathbuni, Didemnum spp, poryphers and bryozoans. Diversity index and percent cover at reef stations placed at 11, 18 and 30 meters isobaths were respectively 2.28 and 66.7%, 2.79 and 96.6% and 1.66 and 77.4%. Differences of general community structure among the three assemblages were not clearly related to the general environmental conditions at the bottom layers near the reef stations. Turbidity and larval abundance are discussed as important factors affecting colonization processes. Results indicate that depths between 15-20 meters are more suitable for the implementation of large scale artificial reef systems in the inner shelf off Paraná and, possibly, throughout the inner shelves off southern Brazil with similar hydrographic conditions.

Do school based food and nutrition policies improve diet and reduce obesity?

OBJECTIVE: To review the effectiveness of school food and nutrition policies world wide in improving the school food environment, student's dietary intake, and decreasing overweight and obesity. METHODS: Systematic review of published and unpublished literature up to November 2007 of three categories of nutrition policy; nutrition guidelines, regulation of food and/or beverage availability, and price interventions applied in preschools, primary and secondary schools. RESULTS: 18 studies met the inclusion criteria. Most evidence of effectiveness was found for the impact of both nutrition guidelines and price interventions on intake and availability of food and drinks, with less conclusive research on product regulation. Despite the introduction of school food policies worldwide few large scale or national policies have been evaluated, and all included studies were from the USA and Europe. CONCLUSION: Some current school policies have been effective in improving the food environment and dietary intake in schools, but there is little evaluation of their impact on BMI. As schools have been proposed worldwide as a major setting for tackling childhood obesity it is essential that future policy evaluations measure the long term effectiveness of a range of school food policies in tackling both dietary intake and overweight and obesity.

High-throughput SNP genotyping in the highly heterozygous genome of Eucalyptus: assay success, polymorphism and transferability across species

Background: High-throughput SNP genotyping has become an essential requirement for molecular breeding and population genomics studies in plant species. Large scale SNP developments have been reported for several mainstream crops. A growing interest now exists to expand the speed and resolution of genetic analysis to outbred species with highly heterozygous genomes. When nucleotide diversity is high, a refined diagnosis of the target SNP sequence context is needed to convert queried SNPs into high-quality genotypes using the Golden Gate Genotyping Technology (GGGT). This issue becomes exacerbated when attempting to transfer SNPs across species, a scarcely explored topic in plants, and likely to become significant for population genomics and inter specific breeding applications in less domesticated and less funded plant genera. Results: We have successfully developed the first set of 768 SNPs assayed by the GGGT for the highly heterozygous genome of Eucalyptus from a mixed Sanger/454 database with 1,164,695 ESTs and the preliminary 4.5X draft genome sequence for E. grandis. A systematic assessment of in silico SNP filtering requirements showed that stringent constraints on the SNP surrounding sequences have a significant impact on SNP genotyping performance and polymorphism. SNP assay success was high for the 288 SNPs selected with more rigorous in silico constraints; 93% of them provided high quality genotype calls and 71% of them were polymorphic in a diverse panel of 96 individuals of five different species. SNP reliability was high across nine Eucalyptus species belonging to three sections within subgenus Symphomyrtus and still satisfactory across species of two additional subgenera, although polymorphism declined as phylogenetic distance increased. Conclusions: This study indicates that the GGGT performs well both within and across species of Eucalyptus notwithstanding its nucleotide diversity >= 2%. The development of a much larger array of informative SNPs across multiple Eucalyptus species is feasible, although strongly dependent on having a representative and sufficiently deep collection of sequences from many individuals of each target species. A higher density SNP platform will be instrumental to undertake genome-wide phylogenetic and population genomics studies and to implement molecular breeding by Genomic Selection in Eucalyptus.

Poly (A)(+) Transcriptome Assessment of ERBB2-Induced Alterations in Breast Cell Lines

We report the first quantitative and qualitative analysis of the poly (A)(+) transcriptome of two human mammary cell lines, differentially expressing (human epidermal growth factor receptor) an oncogene over-expressed in approximately 25% of human breast tumors. Full-length cDNA populations from the two cell lines were digested enzymatically, individually tagged according to a customized method for library construction, and simultaneously sequenced by the use of the Titanium 454-Roche-platform. Comprehensive bioinformatics analysis followed by experimental validation confirmed novel genes, splicing variants, single nucleotide polymorphisms, and gene fusions indicated by RNA-seq data from both samples. Moreover, comparative analysis showed enrichment in alternative events, especially in the exon usage category, in ERBB2 over-expressing cells, data indicating regulation of alternative splicing mediated by the oncogene. Alterations in expression levels of genes, such as LOX, ATP5L, GALNT3, and MME revealed by large-scale sequencing were confirmed between cell lines as well as in tumor specimens with different ERBB2 backgrounds. This approach was shown to be suitable for structural, quantitative, and qualitative assessment of complex transcriptomes and revealed new events mediated by ERBB2 overexpression, in addition to potential molecular targets for breast cancer that are driven by this oncogene.

Suppression subtractive hybridization profiles of radial growth phase and metastatic melanoma cell lines reveal novel potential targets

Background: Melanoma progression occurs through three major stages: radial growth phase (RGP), confined to the epidermis; vertical growth phase (VGP), when the tumor has invaded into the dermis; and metastasis. In this work, we used suppression subtractive hybridization (SSH) to investigate the molecular signature of melanoma progression, by comparing a group of metastatic cell lines with an RGP-like cell line showing characteristics of early neoplastic lesions including expression of the metastasis suppressor KISS1, lack of alpha v beta 3-integrin and low levels of RHOC. Methods: Two subtracted cDNA collections were obtained, one (RGP library) by subtracting the RGP cell line (WM1552C) cDNA from a cDNA pool from four metastatic cell lines (WM9, WM852, 1205Lu and WM1617), and the other (Met library) by the reverse subtraction. Clones were sequenced and annotated, and expression validation was done by Northern blot and RT-PCR. Gene Ontology annotation and searches in large-scale melanoma expression studies were done for the genes identified. Results: We identified 367 clones from the RGP library and 386 from the Met library, of which 351 and 368, respectively, match human mRNA sequences, representing 288 and 217 annotated genes. We confirmed the differential expression of all genes selected for validation. In the Met library, we found an enrichment of genes in the growth factors/receptor, adhesion and motility categories whereas in the RGP library, enriched categories were nucleotide biosynthesis, DNA packing/repair, and macromolecular/vesicular trafficking. Interestingly, 19% of the genes from the RGP library map to chromosome 1 against 4% of the ones from Met library. Conclusion: This study identifies two populations of genes differentially expressed between melanoma cell lines from two tumor stages and suggests that these sets of genes represent profiles of less aggressive versus metastatic melanomas. A search for expression profiles of melanoma in available expression study databases allowed us to point to a great potential of involvement in tumor progression for several of the genes identified here. A few sequences obtained here may also contribute to extend annotated mRNAs or to the identification of novel transcripts.

Continental passive microwave-based rainfall estimation algorithm: Application to the Amazon Basin

This paper presents a new statistical algorithm to estimate rainfall over the Amazon Basin region using the Tropical Rainfall Measuring Mission (TRMM) Microwave Imager (TMI). The algorithm relies on empirical relationships derived for different raining-type systems between coincident measurements of surface rainfall rate and 85-GHz polarization-corrected brightness temperature as observed by the precipitation radar (PR) and TMI on board the TRMM satellite. The scheme includes rain/no-rain area delineation (screening) and system-type classification routines for rain retrieval. The algorithm is validated against independent measurements of the TRMM-PR and S-band dual-polarization Doppler radar (S-Pol) surface rainfall data for two different periods. Moreover, the performance of this rainfall estimation technique is evaluated against well-known methods, namely, the TRMM-2A12 [ the Goddard profiling algorithm (GPROF)], the Goddard scattering algorithm (GSCAT), and the National Environmental Satellite, Data, and Information Service (NESDIS) algorithms. The proposed algorithm shows a normalized bias of approximately 23% for both PR and S-Pol ground truth datasets and a mean error of 0.244 mm h(-1) ( PR) and -0.157 mm h(-1)(S-Pol). For rain volume estimates using PR as reference, a correlation coefficient of 0.939 and a normalized bias of 0.039 were found. With respect to rainfall distributions and rain area comparisons, the results showed that the formulation proposed is efficient and compatible with the physics and dynamics of the observed systems over the area of interest. The performance of the other algorithms showed that GSCAT presented low normalized bias for rain areas and rain volume [0.346 ( PR) and 0.361 (S-Pol)], and GPROF showed rainfall distribution similar to that of the PR and S-Pol but with a bimodal distribution. Last, the five algorithms were evaluated during the TRMM-Large-Scale Biosphere-Atmosphere Experiment in Amazonia (LBA) 1999 field campaign to verify the precipitation characteristics observed during the easterly and westerly Amazon wind flow regimes. The proposed algorithm presented a cumulative rainfall distribution similar to the observations during the easterly regime, but it underestimated for the westerly period for rainfall rates above 5 mm h(-1). NESDIS(1) overestimated for both wind regimes but presented the best westerly representation. NESDIS(2), GSCAT, and GPROF underestimated in both regimes, but GPROF was closer to the observations during the easterly flow.