999 resultados para João Salgado de Araújo


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Post-menopause is characterized as the period beginning one year after the permanent cessation of menstrual cycles, which is typically related to medical disorders that, in association with Metabolic Syndrome (MS), represent a set of cardiovascular risk factors. Objective: To assess dietary intake and the prevalence of metabolic syndrome in postmenopausal women, according to the level of physical activity. Methods: The sample consisted of 82 women, evaluated in the Northern Zone of the city of Natal / RN who were participants in the Natal Active Program. People completed a Food Frequency Consumption Questionnaire (FFCQ) and were interviewed about physical activity. Anthropometric measurements and biochemical tests were used to diagnose MS (Metabolic Syndrome). Result: The active women consumed more protective foods (flaxseed, nuts, whole wheat bread, brown rice and olive oil) than inactive women. Risky foods (sugar, crackers, white bread, white rice, margarine and beef) were consumed more by the group of inactive women. The prevalence of MS was higher in inactive women (53.30%) than in physically active women (46.70%). Conclusion: Active post-menopausal women had a higher daily intake of protective foods in relation to cardiovascular disease, while the inactive post-menopausal women had higher intake of risky foods for such diseases

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A descriptive and exploratory Study, quantitative in nature, with the aim to assess the Quality of Life (QL) of the elderly leaving in a Long Residence Institution (LRI) according to their own perception. It was conducted in six Public Institutions of Long Residence for Seniors, in the municipality of Natal - RN, in the period of July to August 2007. The data was collected using two structured interview forms: the first, containing questions about socio-demographic aspects and the second - the WHOQUOL-OLD, prepared by the World Health Organization to assess elderly s quality of life. The reference population was 266 old persons, and a random sample, of 43, being 28 women and 15 men, who account for 30%. The results indicated there is a predominance of older women (65.1%) and the average age is 76.6 years; the predominant religion is the Catholic - 44.2% and, 32.6% are unmarried without children. As for schooling and precedence, 41.9% are illiterate and 67.4% come from the rural area. The time of residency in the institution goes between 1 to 5 years for 69.8% of the elderly, 37.2% of them residing in the institution for not having another option. Most elderly informed using medicines. 51.3% said they are taking anti-hypertensive. As for the other aspects of QL: sensory aspects, autonomy, past, present and future activities, social participation, death and dying and intimacy, the WHOQOL-OLD, showed an average total score of 52.9% (scale of 0 to 100), with a tendency to neutrality, denoting that the elderly, in this study, evaluated their QL as neither satisfactory or unsatisfactory. Of all the facets of the instrument of QL, the sensory facet secured the highest average scores (68,1%), showing that the elderly are "happy" in the situation in which they find themselves, not showing significant disabilities. The facet of autonomy, which refers to the independence and the ability to make decisions on their own life, received the lowest average scores (40.7%), showing the dissatisfaction of the elderly on this aspect. The evaluation of the elderly on other facets were: social participation (48.2%); activities past, present and future (44.6%) and intimacy (50.6%), all perceived as neither unsatisfactory or satisfactory. On the item death and dying, the elderly people declared themselves satisfied, with average score of 65.5%. The analysis of the reliability of the WHOQOL-OLD by the Cronbach Alpha showed 0.57, considering the 24 items that cover the instrument, showing regular internal reliability of the instrument, in our reality. The result is probably due to differences between the regions south and east and the broader sociocultural diversity. We believe that the elderly in this study, tended to realize their QL as neutral, considering it as neither unsatisfactory or satisfactory, result likely related to the resignation with the destine, characterized, at the time, by the finitude of life, feeling very common among elderly, or perhaps, even for an accommodation, often accompanied by discouragement, present in the daily life of many of them

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Acacia polyphyla (Mimosaceae) é uma espécie arbórea nativa do Brasil, importante para a recuperação de áreas degradadas. Sementes dessa espécie foram armazenadas em condições naturais e artificiais, com os objetivos de avaliar a longevidade das sementes no solo, conservar a sua qualidade fisiológica pelo período correspondente a duas colheitas e verificar o requerimento fotoblástico das sementes armazenadas. em condições naturais, as sementes foram enterradas em clareira, sob dossel ralo e sob dossel denso. As sementes deterioraram rapidamente, revelando-se incapazes de compor o banco de sementes do solo. em condições artificiais, as sementes foram acondicionadas em diferentes embalagens e armazenadas por dois anos em ambiente não controlado e em câmara fria. Periodicamente, as sementes foram colocadas para germinar a 25ºC, na ausência de luz e sob fotoperíodo de oito horas sob luzes branca e de sombreamento. Durante todo o período de armazenamento, a germinação no escuro foi inferior à constatada sob luzes branca e de sombreamento. A qualidade fisiológica foi conservada por dois anos, quando as sementes foram acondicionadas em embalagem impermeável e armazenadas em câmara fria. O comportamento germinativo das sementes armazenadas por dois anos foi comparado com o de sementes recém-colhidas, em temperaturas constante e alternada, não sendo constatado efeito da idade e do regime de temperatura no requerimento fotoblástico das sementes.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Communication is seen as vital function. Through it, individuals and organizations relate to each other, the environment and the shares of their own group, influencing each other to turn facts into information. The user of the male part of a group of patients whose health policy is still in development. This fact can create insecurity in the nurse to establish a process that promotes disease prevention, promotion and / or recovery of health for that user. Aiming to elucidate this, the present study aimed to: apprehend the social representations of nurses communication with the users were male, looking for disease prevention, promotion and recovery of his health; identify the factors that influenced, positively or negatively on the effectiveness of nurses communication with the users were male and investigate the strategies used by nurses to clarify communication with the users were male. In order to achieve the goal raised, this study was a descriptive, exploratory and qualitative approach. Was based on theoretical and methodological framework social representations of Denise Jodelet and Serge Moscovici. The project has, through no Parecer nº 649/10, approval of the Ethics and Research HULW. During data collection, we used a semi-structured script and a diary interviews with 24 nurses in basic health units of district-Mangabeira Health District III, the city of João Pessoa (PB). The results were analyzed using the technique of content analysis according to Bardin (2007). Classifying the research subjects and identified three categories and five nuclei of the central ideas. The categories identified: the grasp of the RS communication of nurses with male users, identifying factors that influence the effectiveness of nurses' communication with users and male research on the strategies used by nurses to the elucidation of the communication with male users. The nuclei of the central ideas found: social representations of nurses' communication with the users of the male is externalized as difficult, different, difficult, not technical (knowledge) specific, with a dubious sense in relation to its therapeutic action, the factors examined as positive in this communication were based on the connection between professional and user look in detail and not mechanistic, in preventive actions, the dynamics of care, accessibility, participatory care, humanization, and qualification service. Whereas served as negative factors for the communication, signed on the behavioral differences of men, the feminization of nurses, lack of training for professionals in relation to the subject, prescriptive conduct and prejudice (concerns) sociocultural. Another related consolidated core strategies employed for the occurrence of such communication. Given these results, it was realized the importance of social representations for the consecration of a single language, the common understanding of reality on the nurse's communication with the user in male and determination of changes in the behavior of nurses and the user to the establishment of more effective strategies for obtaining a therapeutic communication between them

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Acacia polyphylla DC. é uma espécie arbórea, característica dos estádios iniciais da sucessão secundária, de ocorrência natural no Brasil. Pertence à família Leguminosae-Mimosoideae, sendo recomendada em programas de reflorestamento misto, recuperação de áreas degradadas e manejo de fragmentos florestais. Entretanto, não foi encontrado nenhuma referência que fizesse menção aos aspectos químicos e morfológicos das sementes, bem como, aos aspectos do desenvolvimento pós-seminal desta espécie. Assim sendo, o presente trabalho objetivou caracterizar morfologicamente e ilustrar frutos e sementes, quantificar alguns componentes químicos presentes nas sementes e descrever as diferentes fases do desenvolvimento pós-seminal. Para tanto, foram realizadas descrições associadas às estruturas externa e interna das sementes. As descrições morfológicas dos frutos e das sementes foram efetuadas em relação a forma, ao tamanho, a superfície, a micrópila e a forma e a localização do embrião. Para a descrição morfológica das plântulas, as sementes foram colocadas para germinar em meio de cultura Murashige & Skoog reduzido à metade da concentração e incubadas a temperatura de 25ºC, sendo descritas e ilustradas as plântulas normais e anormais. O fruto é uma vagem deiscente contendo de oito a 16 sementes achatadas, de tegumento testal, embrião axial e invaginado. A germinação das sementes é epígea e as plântulas fanerocotiledonares.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This paper presents metaheuristic strategies based on the framework of evolutionary algorithms (Genetic and Memetic) with the addition of Technical Vocabulary Building for solving the Problem of Optimizing the Use of Multiple Mobile Units Recovery of Oil (MRO units). Because it is an NP-hard problem, a mathematical model is formulated for the problem, allowing the construction of test instances that are used to validate the evolutionary metaheuristics developed

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The objective of this research is to discuss about the need for implementation of new alternatives for the implementation on the metrological control: on the findings of initial and subsequent measurements, the control procedures of measurement uncertainty applied in assessing the loss or remains found in handling operations of bulk liquids, when used turbine meters used in measuring the tax on the business of Petrobras, due to the current environment of legal metrology and scientific, both domestic and international. We aim, with these alternatives: standardizing the minimization of random and systematic errors, the estimate of the remaining errors, as well as the management control of metrological calibration procedures, control of measurement uncertainty, and contribute to the change in the form of performance of legal metrology and scientific disseminating new information to change management of metrological control, objectively focused on aspects of supervision in implementing these activities in the control of the uncertainties of measurement used in our processes in the fiscal measurement system Petrobras. Results are presented, information and comments on the influence of measurement uncertainty in the current results of the fiscal and transfer of custody. This will emphasize the need, among other things, improvement and expansion of metrological control monitored by setting a better meet demand, calibration equipment and measuring instruments for Petrobras. Finally, we intend to establish the need for improving the method of evaluation of the data meter applied to the current management control of measurement uncertainty by proposing a methodology for addressing the problem, as well as highlighting the expected results.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This work proposes a computer simulator for sucker rod pumped vertical wells. The simulator is able to represent the dynamic behavior of the systems and the computation of several important parameters, allowing the easy visualization of several pertinent phenomena. The use of the simulator allows the execution of several tests at lower costs and shorter times, than real wells experiments. The simulation uses a model based on the dynamic behavior of the rod string. This dynamic model is represented by a second order partial differencial equation. Through this model, several common field situations can be verified. Moreover, the simulation includes 3D animations, facilitating the physical understanding of the process, due to a better visual interpretation of the phenomena. Another important characteristic is the emulation of the main sensors used in sucker rod pumping automation. The emulation of the sensors is implemented through a microcontrolled interface between the simulator and the industrial controllers. By means of this interface, the controllers interpret the simulator as a real well. A "fault module" was included in the simulator. This module incorporates the six more important faults found in sucker rod pumping. Therefore, the analysis and verification of these problems through the simulator, allows the user to identify such situations that otherwise could be observed only in the field. The simulation of these faults receives a different treatment due to the different boundary conditions imposed to the numeric solution of the problem. Possible applications of the simulator are: the design and analysis of wells, training of technicians and engineers, execution of tests in controllers and supervisory systems, and validation of control algorithms

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The topology optimization problem characterize and determine the optimum distribution of material into the domain. In other words, after the definition of the boundary conditions in a pre-established domain, the problem is how to distribute the material to solve the minimization problem. The objective of this work is to propose a competitive formulation for optimum structural topologies determination in 3D problems and able to provide high-resolution layouts. The procedure combines the Galerkin Finite Elements Method with the optimization method, looking for the best material distribution along the fixed domain of project. The layout topology optimization method is based on the material approach, proposed by Bendsoe & Kikuchi (1988), and considers a homogenized constitutive equation that depends only on the relative density of the material. The finite element used for the approach is a four nodes tetrahedron with a selective integration scheme, which interpolate not only the components of the displacement field but also the relative density field. The proposed procedure consists in the solution of a sequence of layout optimization problems applied to compliance minimization problems and mass minimization problems under local stress constraint. The microstructure used in this procedure was the SIMP (Solid Isotropic Material with Penalty). The approach reduces considerably the computational cost, showing to be efficient and robust. The results provided a well defined structural layout, with a sharpness distribution of the material and a boundary condition definition. The layout quality was proporcional to the medium size of the element and a considerable reduction of the project variables was observed due to the tetrahedrycal element

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This work aims at the implementation and adaptation of a computational model for the study of the Fischer-Tropsch reaction in a slurry bed reactor from synthesis gas (CO+H2) for the selective production of hydrocarbons (CnHm), with emphasis on evaluation of the influence of operating conditions on the distribution of products formed during the reaction.The present model takes into account effects of rigorous phase equilibrium in a reactive flash drum, a detailed kinetic model able of predicting the formation of each chemical species of the reaction system, as well as control loops of the process variables for pressure and level of slurry phase. As a result, a system of Differential Algebraic Equations was solved using the computational code DASSL (Petzold, 1982). The consistent initialization for the problem was based on phase equilibrium formed by the existing components in the reactor. In addition, the index of the system was reduced to 1 by the introduction of control laws that govern the output of the reactor products. The results were compared qualitatively with experimental data collected in the Fischer-Tropsch Synthesis plant installed at Laboratório de Processamento de Gás - CTGÁS-ER-Natal/RN

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The pegmatite rocks in Rio Grande do Norte are responsible for much of the production of industrial minerals like quartz and feldspar. Quartz and feldspar are minerals from pegmatite which may occur in pockets with metric to centimetric dimensions or as millimetric to sub millimetric intergrowths. The correct physical liberation of the mineral of interest, in case of intergrowths, requires an appropriate particle size, acquired by size reduction operations. The method for treating mineral which has a high efficiency fines particles recovery is flotation. The main purpose of the present study is to evaluate the recovery of quartz and potassium feldspar using cationic diamine and quaternary ammonium salt as collectors by means of dissolved air flotation DAF. The tests were performed based on a central composite design 24, by which the influence of process variables was statistically verified: concentration of the quaternary ammonium salt and diamine collectors, pH and conditioning time. The efficiency of flotation was calculated from the removal of turbidity of the solution. Results of maximum flotation efficiency (60%) were found in the level curves, plotted in conditions of low concentrations of collectors (1,0 x 10-5 mol.L-1). These high flotation efficiencies were obtained when operating at pH 4 to 8 with conditioning time ranging from 3 to 5 minutes. Thus, the results showed that the process variables have played important roles in the dissolved air flotation process concerning the flotability of the minerals.