The novels and tales of Robert Louis Stevenson /

"Index to the Thistle edition, comp. by F. D. Tandy": vol. 22, p. 645-669.

1903 University of Michigan Football Team

1903 University of Michigan Baseball Team

Top Row: student mngr Earle F. Potter, William C. Cole, Robert Cutting, Henry Karsten, Thomas Bird, Charles Baird

Middle Row: Charles Campbell, Andrew Roche, Jerome Utley, Curtis Redden, Marion Wolfe

Front Row: Edgar Carrothers, Thurber Davis

The novels and tales of Robert Louis Stevenson ...

Criticisms, etc.--XXIII-XXIV. Letters to his family and friends, selected and ed. ... by S. Colvin.--XXV-XXVI. The life of Robert Louis Stevenson, by G. Balfour.--XXVII. New letters, selected and ed. by S. Colvin.

The faith of Robert Louis Stevenson /

Includes index.

Works of Robert Burns: with an account of his life, and criticism on his writings. to which are prefixed, some observtions on the character and condition of the Scottish peasantry.

Mode of access: Internet.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Description of the pupal case of Systropus (Systropus) nitidus Wiedemann, 1830 (Diptera, Bombyliidae, Toxophorinae, Systropodini)

The pupal case of Systropus (Systropus) nitidus Wiedemann reared from an unidentified tipical Limacodidae (Lepidoptera) cocoon is described and illustrated for the first time. Only species of Limacodidae are recorded as host of the immature stages of S. (Systropus). The geographical distribution of S. (Systropus) nitidus is restricted to Brazil, from Pará to Santa Catarina states. This is the first pupal case description and illustration of a Neotropical species of the subgenus Systropus.

A phylogenetic study of the subtribe Dicrepidiina (Elateridae, Elaterinae, Ampedini)

It is presented a cladistic analysis of the Dicrepidiina aiming to test the monophyletism of the subtribe and to establish the relationships among the genera. The subtribe is composed by 36 genera and all of them, except Asebis, Lamononia, Neopsephus, Semiotopsis and Spilomorphus were included in the analysis. Fifty two species, especially the type-species of each genus were studied: Achrestus flavocinctus (Candèze, 1859), A. venustus Champion, 1895, Adiaphorus gracilis Schwarz, 1901, A. ponticerianus Candèze, 1859, Anoplischiopsis bivittatus Champion, 1895, Anoplischius bicarinatus Candèze, 1859, A. conicus Candèze, 1900, A. haematopus Candèze, 1859, A. pyronotus Candèze, 1859, Atractosomus flavescens (Germar, 1839), Blauta cribraria (Germar, 1844), Calopsephus apicalis (Schwarz, 1903), Catalamprus angustus (Fleutiaux, 1902), Crepidius flabellifer (Erichson, 1847), C. resectus Candèze, 1859, Cyathodera auripilosus Costa, 1968, C. lanugicollis (Candèze, 1859), C. longicornis Blanchard, 1843, Dayakus angularis Candèze, 1893, Dicrepidius ramicornis (Palisot de Beauvois, 1805), Dipropus brasilianus (Germar, 1824), D. factuellus Candèze, 1859, D. laticollis (Eschscholtz, 1829), D. pinguis (Candèze, 1859), D. schwarzi (Becker, 1961), Elius birmanicus Candèze, 1893, E. dilatatus Candèze, 1878, Heterocrepidius gilvellus Candèze, 1859, H. ventralis Guérin-Méneville, 1838, Lampropsephus cyaneus (Candèze, 1878), Loboederus appendiculatus (Perty, 1830), Olophoeus gibbus Candèze, 1859, Ovipalpus pubescens Solier, 1851, Pantolamprus ligneus Candèze, 1896, P. mirabilis Candèze, 1896, P. perpulcher Westwood, 1842, Paraloboderus glaber Golbach, 1990, Proloboderus crassipes Fleutiaux, 1912, Propsephus beniensis (Candèze, 1859), P. cavifrons (Erichson, 1843), Pseudolophoeus guineensis (Candèze, 1881), Rhinopsephus apicalis (Schwarz, 1903), Sephilus formosanus Schwarz, 1912, S. frontalis Candèze, 1878, Singhalenus gibbus Candèze, 1892, S. taprobanicus Candèze, 1859, Sphenomerus antennalis Candèze, 1859, S. brunneus Candèze, 1865, Spilus atractomorphus Candèze, 1859, S. nitidus Candèze, 1859, Stenocrepidius simonii Fleutiaux, 1891 and Trielasmus varians Blanchard, 1846. Chalcolepidius zonatus (Hemirhipini, Agrypninae), Ctenicera silvatica (Prosternini, Prosterninae), and species of the other subtribes of Ampedini (Elaterinae): Ampedus sanguineus (Ampedina), Melanotus spernendus (Melanotina) and Anchastus digittatus and Physorhinus xanthocephalus (Physorhinina) were used as outgroups. The results of the phylogenetic analysis demonstrated that Dicrepidiina, as formerly defined, does not form a monophyletic group. One genus, represented by Ovipalpus pubescens, was removed from the subtribe. The subtribe is characterized by presence of lamella under 2nd and 3rd tarsomeres of all legs. Also, it was revealed that the genera Achrestus, Anoplischius, Dipropus and Propsephus are not monophyletic. Due to the scarcity of information, all the studied species are redescribed and illustrated.

Cytogenetic analysis of Astylus antis (Perty, 1830) (Coleoptera, Melyridae): Karyotype, heterochromatin and location of ribosomal genes

Cytogenetic analysis of Astylus antis using mitotic and meiotic cells was performed to characterize the haploid and diploid numbers, sex determination system, chromosome morphology, constitutive heterochromatin distribution pattern and chromosomes carrying nucleolus organizer regions (NORs). Analysis of spermatogonial metaphase cells revealed the diploid number 2n = 18, with mostly metacentric chromosomes. Metaphase I cells exhibited 2n = 8II+Xyp and a parachute configuration of the sex chromosomes. Spermatogonial metaphase cells submitted to C-banding showed the presence of small dots of constitutive heterochromatin in the centromeric regions of nearly all the autosomes and on the short arm of the X chromosome (Xp), as well as an additional band on one of the arms of pair 1. Mitotic cells submitted to double staining with base-specific fluorochromes (DAPI-CMA3) revealed no regions rich in A+T or G+C sequences. Analysis of spermatogonial mitotic cells after sequential Giemsa/AgNO3 staining did not reveal any specific mark on the chromosomes. Meiotic metaphase I cells stained with silver nitrate revealed a strong impregnation associated to the sex chromosomes, and in situ hybridization with an 18S rDNA probe showed ribosomal cistrons in an autosomal bivalent.

Hygienic behavior of the stingless bee Plebeia remota (Holmberg, 1903) (Apidae, Meliponini)

We investigated hygienic behavior in 10 colonies of Plebeia remota, using the pin-killed method. After 24 h the bees had removed a mean of 69.6% of the dead brood. After 48 h, the bees had removed a mean of 96.4% of the dead brood. No significant correlation was found between the size of the brood comb and the number of dead pupae removed, and there was no apparent effect of the origin and the condition of the colony on the hygienic behavior of the bees. Plebeia remota has an efficiency of hygienic behavior superior to that of three of the other four stingless bee species studied until now.

Letters that construct limits: intellectual and political projects in the letters of Capistrano de Abreu to Barao do Rio Branco (1886-1903)

The intention of this paper is to analyze the letters from Capistrano de Abreu to Barao do Rio Branco in the years between 1886 and 1903. The focus will be given to the divergences around the notion of territorial formation, a basic concept for these authors who were thinking about the construction of a historical narrative at the end of the 19(th) and beginning of the 20(th) century. Later, the question is the construction of the craft of the historian in the letters of Capistrano de Abreu and his distinction and proximity to the ideas of the Barao do Rio Branco.