975 resultados para SEQUENCE VARIATION


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Antibodies were raised in rabbits against the bovine serum albumin conjugate of dpApT. Analysis by double diffusion in agar gel and quantitative precipitation test showed the presence of antibodies specific to the hapten in the antisera. Quantitative data on the specificity of the antibodies were obtained by studying the inhibition of the binding of 3H-dpApT to the anti-sera by various nonradioactive mono- and oligonucleotides, using a nitrocellulose membrane binding assay. The antibodies were found to be highly specific for the dinucleotide sequence dpApT. The antibodies were able to bind to synthetic oligonucleotides containing the sequence dpApT and to denatured calf thymus DNA.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Growth is a fundamental aspect of life cycle of all organisms. Body size varies highly in most animal groups, such as mammals. Moreover, growth of a multicellular organism is not uniform enlargement of size, but different body parts and organs grow to their characteristic sizes at different times. Currently very little is known about the molecular mechanisms governing this organ-specific growth. The genome sequencing projects have provided complete genomic DNA sequences of several species over the past decade. The amount of genomic sequence information, including sequence variants within species, is constantly increasing. Based on the universal genetic code, we can make sense of this sequence information as far as it codes proteins. However, less is known about the molecular mechanisms that control expression of genes, and about the variations in gene expression that underlie many pathological states in humans. This is caused in part by lack of information about the second genetic code that consists of the binding specificities of transcription factors and the combinatorial code by which transcription factor binding sites are assembled to form tissue-specific and/or ligand-regulated enhancer elements. This thesis presents a high-throughput assay for identification of transcription factor binding specificities, which were then used to measure the DNA binding profiles of transcription factors involved in growth control. We developed ‘enhancer element locator’, a computational tool, which can be used to predict functional enhancer elements. A genome-wide prediction of human and mouse enhancer elements generated a large database of enhancer elements. This database can be used to identify target genes of signaling pathways, and to predict activated transcription factors based on changes in gene expression. Predictions validated in transgenic mouse embryos revealed the presence of multiple tissue-specific enhancers in mouse c- and N-Myc genes, which has implications to organ specific growth control and tumor type specificity of oncogenes. Furthermore, we were able to locate a variation in a single nucleotide, which carries a susceptibility to colorectal cancer, to an enhancer element and propose a mechanism by which this SNP might be involved in generation of colorectal cancer.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This thesis used multidisciplinary approaches which greatly enhance our understanding of population structure and can be particularly powerful tools for resolving variation of melon fly over geographic and temporal scales, and for determining invasive pathways. The results from this thesis reinforce the value of integrating multiple data sets to better understand and resolve natural variation within an important pest to determine whether there are cryptic species, discrete lineages or host races, and to identify dispersal pathways in an invasive pest. These results are instructive for regional biosecurity, trade and quarantine, and provide important background for future area-wide management programmes. The integrative methodology adopted in this thesis is applicable to a variety of other insect pests.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Mixed-species bird flocks are attractive models for the investigation of geographical variation in animal communities, as they represent a subset of the avifauna in most forested regions of the world. Yet studies of the regional variation in flock size and the composition of flocks are few, due to the predominance of studies carried out at single study site. Here, we review nine studies of mixed-species flocks conducted at 16 sites along the Western Ghats in India and in Sri Lanka. We find that flock size varies as much within this region as it does globally, with observation time being a confounding variable. Flock composition, however, is predictably related to elevation. Flocks at high elevations (>1200 m) in the Western Ghats strongly resemble flocks at high elevations in the mountain ranges of Sri Lanka in their composition, especially at the family level. We compare these flocks to flocks of other regions and make recommendations on study methodology that can facilitate comparisons across studies.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Defence against pathogens is a vital need of all living organisms that has led to the evolution of complex immune mechanisms. However, although immunocompetence the ability to resist pathogens and control infection has in recent decades become a focus for research in evolutionary ecology, the variation in immune function observed in natural populations is relatively little understood. This thesis examines sources of this variation (environmental, genetic and maternal effects) during the nestling stage and its fitness consequences in wild populations of passerines: the blue tit (Cyanistes caeruleus) and the collared flycatcher (Ficedula albicollis). A developing organism may face a dilemma as to whether to allocate limited resources to growth or to immune defences. The optimal level of investment in immunity is shaped inherently by specific requirements of the environment. If the probability of contracting infection is low, maintaining high growth rates even at the expense of immune function may be advantageous for nestlings, as body mass is usually a good predictor of post-fledging survival. In experiments with blue tits and haematophagous hen fleas (Ceratophyllus gallinae) using two methods, methionine supplementation (to manipulate nestlings resource allocation to cellular immune function) and food supplementation (to increase resource availability), I confirmed that there is a trade-off between growth and immunity and that the abundance of ectoparasites is an environmental factor affecting allocation of resources to immune function. A cross-fostering experiment also revealed that environmental heterogeneity in terms of abundance of ectoparasites may contribute to maintaining additive genetic variation in immunity and other traits. Animal model analysis of extensive data collected from the population of collared flycatchers on Gotland (Sweden) allowed examination of the narrow-sense heritability of PHA-response the most commonly used index of cellular immunocompetence in avian studies. PHA-response is not heritable in this population, but is subject to a non-heritable origin (presumably maternal) effect. However, experimental manipulation of yolk androgen levels indicates that the mechanism of the maternal effect in PHA-response is not in ovo deposition of androgens. The relationship between PHA-response and recruitment was studied for over 1300 collared flycatcher nestlings. Multivariate selection analysis shows that it is body mass, not PHA-response, that is under direct selection. PHA-response appears to be related to recruitment because of its positive relationship with body mass. These results imply that either PHA-response fails to capture the immune mechanisms that are relevant for defence against pathogens encountered by fledglings or that the selection pressure from parasites is not as strong as commonly assumed.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The life cycle and genetic diversity of the red alga Furcellaria lumbricalis (Hudson) Lamouroux were investigated in 15 populations in northern Europe. The occurrence of different life cycle phases and seasonality of reproduction were studied in four brackish populations in the northern Baltic Sea. Furthermore, a new method, based on genome screening with ISSR markers combined with a restriction-ligation method, was developed to discover microsatellite markers for population genetic analyses. The mitochondrial DNA cox2-3 spacer sequence and four microsatellite markers were used to examine the genetic diversity and differentiation of red algal populations in northern Europe. In addition, clonality and small-scale genetic structure of one Irish and four Baltic Sea populations were studied with microsatellite markers. It was discovered that at the low salinities of the northern Baltic Sea, only tetrasporophytes and males were present in the populations of F. lumbricalis and that winter was the main season for tetrasporangial production. Furthermore, the population occurring at the lowest salinity (3.6 practical salinity units, psu) did not produce spores. The size of the tetraspores was smaller in the Baltic Sea populations than that in the Irish population, and there were more deformed spores in the Baltic Sea populations than in the Irish populations. Studies with microsatellite markers indicated that clonality is a common phenomenon in the Baltic Sea populations of F. lumbricalis, although the proportion of clonal individuals varied among populations. Some genetic divergence occurred within locations both in Ireland and in the northern Baltic Sea. Even though no carpogonia were detected in the field samples during the study, the microsatellite data indicated that sexual reproduction occurs at least occasionally in the northern Baltic Sea. The genetic diversity of F. lumbricalis was highest in Brittany, France. Since no variation was discovered in the mtDNA cox2-3 spacer sequence, which is generally regarded as an informative phylogeographic marker in red algae, it can be assumed that the studied populations probably share the same origin.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Reaction of the bromoketals 3, 7a-g and 11 with tri-n-butyltin chloride and sodium cyanoborohydride in the presence of a catalytic amount of AIBN furnished the ethers 5, 8a-g and 13 via a tandem sequence comprising of a radical cyclisation reaction and tri-n-butylhalostannane and sodium cyanoborohydride mediated reductive demethoxylation of the resulting cyclic ketals.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The 3prime terminal 1255nt sequence of Physalis mottle virus (PhMV) genomic RNA has been determined from a set of overlapping cDNA clones. The open reading frame (ORF) at the 3prime terminus corresponds to the amino acid sequence of the coat protein (CP) determined earlier except for the absence of the dipeptide, Lys-Leu, at position 110-111. In addition, the sequence upstream of the CP gene contains the message coding for 178 amino acid residues of the C-terminus of the putative replicase protein (RP). The sequence downstream of the CP gene contains an untranslated region whose terminal 80 nucleotides can be folded into a characteristic tRNA-like structure. A phylogenetic tree constructed after aligning separately the sequence of the CP, the replicase protein (RP) and the tRNA-like structure determined in this study with the corresponding sequences of other tymoviruses shows that PhMV wrongly named belladonna mottle virus [BDMV(I)] is a separate tymovirus and not another strain of BDMV(E) as originally envisaged. The phylogenetic tree in all the three cases is identical showing that any subset of genomic sequence of sufficient length can be used for establishing evolutionary relationships among tymoviruses.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The incidence of human infections by the fungal pathogen Candida species has been increasing in recent years. Enolase is an essential protein in fungal metabolism. Sequence data is available for human and a number of medically important fungal species. An understanding of the structural and functional features of fungal enolases may provide the structural basis for their use as a target for the development of new anti-fungal drugs. We have obtained the sequence of the enolase of Candida krusei (C. krusei), as it is a significant medically important fungal pathogen. We have then used multiple sequence alignments with various enolase isoforms in order to identify C. krusei specific amino acid residues. The phylogenetic tree of enolases shows that the C. krusei enolase assembles on the tree with the fungal genes. Importantly, C. krusei lacks four amino acids in the active site compared to human enolase, as revealed by multiple sequence alignments. These differences in the substrate binding site may be exploited for the design of new anti-fungal drugs to selectively block this enzyme. The lack of the important amino acids in the active site also indicates that C. krusei enolase might have evolved as a member of a mechanistically diverse enolase superfamily catalying somewhat different reactions.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In this thesis, the genetic variation of human populations from the Baltic Sea region was studied in order to elucidate population history as well as evolutionary adaptation in this region. The study provided novel understanding of how the complex population level processes of migration, genetic drift, and natural selection have shaped genetic variation in North European populations. Results from genome-wide, mitochondrial DNA and Y-chromosomal analyses suggested that the genetic background of the populations of the Baltic Sea region lies predominantly in Continental Europe, which is consistent with earlier studies and archaeological evidence. The late settlement of Fennoscandia after the Ice Age and the subsequent small population size have led to pronounced genetic drift, especially in Finland and Karelia but also in Sweden, evident especially in genome-wide and Y-chromosomal analyses. Consequently, these populations show striking genetic differentiation, as opposed to much more homogeneous pattern of variation in Central European populations. Additionally, the eastern side of the Baltic Sea was observed to have experienced eastern influence in the genome-wide data as well as in mitochondrial DNA and Y-chromosomal variation – consistent with linguistic connections. However, Slavic influence in the Baltic Sea populations appears minor on genetic level. While the genetic diversity of the Finnish population overall was low, genome-wide and Y-chromosomal results showed pronounced regional differences. The genetic distance between Western and Eastern Finland was larger than for many geographically distant population pairs, and provinces also showed genetic differences. This is probably mainly due to the late settlement of Eastern Finland and local isolation, although differences in ancestral migration waves may contribute to this, too. In contrast, mitochondrial DNA and Y-chromosomal analyses of the contemporary Swedish population revealed a much less pronounced population structure and a fusion of the traces of ancient admixture, genetic drift, and recent immigration. Genome-wide datasets also provide a resource for studying the adaptive evolution of human populations. This study revealed tens of loci with strong signs of recent positive selection in Northern Europe. These results provide interesting targets for future research on evolutionary adaptation, and may be important for understanding the background of disease-causing variants in human populations.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

One of the monoclonal antibodies raised against bovine beta-lactoglobulin reacted with human serum retinol binding protein. The finding that this monoclonal antibody also reacted with the serum retinol binding proteins isolated from other animals, suggested that this epitopic conformation is conserved among these proteins. Using ELISA and various synthetic peptides of defined sequence, we show in this paper that the epitope defined by this monoclonal antibody comprises of the highly conserved core sequence of DTDY present in beta-lactoglobulin and retinol binding proteins.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Abstract. We have used chlortetracycline (CTC) as a fluorescent probe to detect the distribution of sequestered calcium in multicellular stages of Dictyostelium discoideum. Tips of late aggregates, slugs and early culminating masses fluoresce very strongly. Most of the fluorescence is intracellular in origin and emanates from a small number of intense punctate sources. The sources correspond in part to autophagic vacuoles viz. neutral-red staining, acidic digestive vesicles, and may also include intracellular organelles; cytoplasmic fluorescence is much weaker in comparison. The level of fluorescence drops in the middle portion of slugs and rises again in the posteriormost region, though not to as high a level as in the tip. This holds good irrespective of whether CTC is applied only in the neighbourhood of the aggregate centre, only in the aggregate periphery, or to the whole aggregate. We infer that there must be a good deal of mixing in the stages leading from aggregation to slug formation; thus the serial order in which cells enter an aggregate does not bear any relation to their ultimate fates. The other implication of our study is that calcium sequestration is much more extensive in prestalk and anterior-like cells than in prespore cells. These findings are discussed with regard to possible implications for pattern formation.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

VP6, the intermediate capsid protein of the virion, specifies subgroup specificity of rotavirus, It is also the most conserved, both at nucleotide and amino acid levels, among group A rotaviruses and is the target of choice for rotavirus detection, In this study we report the sequence of the subgroup I (SGI)-specific VP6 from the serotype G2 strain IS2 isolated from a child suffering from acute diarrhoea in Bangalore ana its comparison with the published VP6 sequences. Interestingly, IS2 gene 6 shared highest homology with that from bovine UK strain and the protein contained substitutions by lysine at amino acid positions 97 and 134, In contrast, the amino acids Met and Glu/Asp at these respective positions are highly conserved in all the other group A rotaviruses sequenced so far, These observations have obvious implications for the evolution of serotype G2 and G2-like strains circulating in India, The SGI VP6, of a human rotavirus, possessing epitopes that are conformationally similar to those found in the native protein in the virion, was successfully expressed in E. coli and purified for the first time by single-step affinity chromatography.