959 resultados para Natural Heritage site


Relevância:

20.00% 20.00%

Publicador:

Resumo:

In this Letter we describe a 12% overall yield synthesis of a model for homoallylic oxygenated alpha-methylene-gamma-butyrolactones with relative stereochemistry defined by selective hydrogenation with Rh/Al(2)O(3). The synthesis was realized in 9 steps involving simple reactions. (C) 2008 Elsevier Ltd. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

As larvae of marine invertebrates age, their response to settlement cues can change. This change can have significant consequences to both the ecology of these organisms, and to their response to antifouling coatings. This study examines how larval age affects the settlement response of larvae to two naturally derived settlement inhibitors, non-polar extracts from the algae Delisea pulchra and Dilophus marginatus, the former of which contains compounds that are in commercial development as antifoulants. Two species of marine invertebrates with non-feeding larvae were investigated: the bryozoans Watersipora subtorquata and Bugula neritina. Larval age strongly affected larval settlement, with older larvae settling at much higher rates than younger larvae. Despite having strong, inhibitory effects on young larvae, the non-polar extracts did not inhibit the settlement of older larvae to the same degree for both species studied. The results show that the effects of ecologically realistic settlement inhibitors are highly dependent on larval age. Given that the age of settling larvae is likely to be variable in the field, such age specific variation in settlement response of larvae may have important consequences for host-epibiont interactions in natural communities.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Background Obesity is related to a higher rate of infections and some types of cancer. Here we analyzed the impact of obesity and weight loss induced by Roux-en-Y gastric bypass (RYGB) on immunological parameters, i.e., cytokine productions and natural killer cell function. Methods We analyzed 28 morbidly obese patients before and 6 months after RYGB. Biochemical parameters were analyzed in plasma. The percent of natural killer (NK) cells, their cytotoxicity, and the production of cytokines by peripheral blood mononuclear cells were analyzed. The percent of NK cells was determined by flow cytometry and cytokine production determined by enzyme-linked immunosorbent assay. NK cytotoxicity was determined by the lactate dehydrogenase release assay. Results The weight loss 6 months following surgery was 35.3 +/- 4.5 kg. RYGB also improves biochemical parameters. No significant difference was found in the percent of NK cells after surgery. We found an increase in the production of interferon-gamma, interleukin (IL)-12 and IL-18, but not in IL-2, 6 months after RYGB. Cytotoxic activity of NK cells was significantly enhanced 6 months after RYGB [17.1 +/- 14.7% before RYGB vs 51.8 +/- 11.3% at 6 months after, at 40: 1 effector to target cell ratio; p<0.001]. We observed significant post-surgical improvement in the cytotoxic activity curve in 22 out of 28 patients (78.6%), irrespective of the target to effector cell ratio. Conclusions The weight loss induced by RYGB modifies the production of cytokines related with NK cell function and improves its activity.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Objective: To correlate the type of dental occlusion and the type of pharyngeal lymphoid tissue obstruction in children. Design: Cross-sectional study. Setting: Ambulatory ear, nose, and throat clinic of Faculdade de Medicina da Universidade de Sao Paulo. Patients: One hundred fourteen children aged 3 to 12 years presenting with mouth breathing and snoring due to tonsil and/or adenoid enlargement. Interventions: Oroscopy and nasal fiber pharyngoscopy complemented by lateral head radiography to diagnose the type of obstruction, and clinical examination to evaluate the dental occlusion. Main Outcome Measures: Tonsil and adenoid obstruction (classified from grades 1-4) and sagittal, transverse, and vertical evaluation of dental occlusion. Results: Obstructive enlargement of both tonsils and adenoids was detected in 64.9% of the sample; isolated enlargement of the adenoids, in 21.9%; isolated enlargement of the palatine tonsils, in 7.0%; and nonobstructive tonsils and adenoids, in 6.1%. All types of pharyngeal obstruction were related to a high prevalence of posterior crossbite (36.8%). Statistically significant association was found between sagittal dental occlusion and the site of lymphoid tissue obstruction (P = .02). A higher rate of class II relationship (43.2%) was detected in the group with combined adenoid and tonsil obstructive enlargement. Isolated tonsil obstruction showed a higher rate of class III relationship (37.5%). Conclusions: Different sites of obstruction of the upper airway due to enlarged lymphoid tissue are associated with different types of dental malocclusion. Findings are relevant to orthodontic and surgical decision making in these mouth-breathing patients.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A conformationally biased decapeptide agonist of human C5a (C5a(65-74)Y65,F67,P69,P71,D-Ala73 or YSFKPMPLaR) was used as a functional probe of the C5a receptor (C5aR) in order to understand the conformational features in the C-terminal effector region of C5a that are important for C5aR binding and signal transduction. YSFKPMPLaR was a potent, full agonist of C5a, but at higher concentrations had a superefficacious effect compared to the natural factor. The maximal efficacy of this analogue was 216 +/- 56% that of C5a in stimulating the release of beta-glucuronidase from human neutrophils. C5aR activation and binding curves both occurred in the same concentration range with YSFKPMPLaR, characteristics not observed with natural C5a or more conformationally flexible C-terminal agonists. YSFKPMPLaR was then used as a C-terminal effector template onto which was synthesized various C5aR binding determinants from the N-terminal core domain of the natural factor. In general, the presence of N-terminal binding determinants had little effect on either potency or binding affinity when the C-terminal effector region was presented to the C5aR in this biologically active conformation. However, one peptide, C5a(12-20)-Ahx-YSFKPMPLaR, expressed a 100-fold increase in affinity for the neutrophil C5aR and a 6-fold increase in potency relative to YSFKPMPLaR. These analyses showed that the peptides used in this study have up to 25% of the potency of C5a in human fetal artery and up to 5% of the activity of C5a in the PMN enzyme release assay.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Herpesviruses, such as murine and human cytomegalovirus (MCMV and HCMV), can establish a persistent infection within the host and have diverse mechanisms as protection from host immune defences'. Several herpesvirus genes that are homologous to host immune modulators have been identified, and are implicated in viral evasion of the host immune response(2,3). The discovery of a viral major histocompatibility complex (MHC) class I homologue, encoded by HCMV(4), led to speculation that it might function as an immune modulator and disrupt presentation of peptides by MHC class I to cytotoxic T cells(5). However, there is no evidence concerning the biological significance of this gene during viral infection. Recent analysis of the MCMV genome has also demonstrated the presence of a MHC class I homologue(6). Here we show that a recombinant MCMV,in which. the gene encoding the class I homologue has been disrupted, has severely restricted replication during the acute stage of infection compared with wild-type MCMV, We demonstrate by in vivo depletion studies that natural killer (NK) cells are responsible for the attenuated phenotype of the mutant. Thus the viral MHC dass I homologue contributes to immune evasion through interference with NK cell-mediated clearance.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

DsbA is a protein-folding catalyst from the periplasm of Escherichia coli that interacts with newly translocated polypeptide substrate and catalyzes the formation of disulfide bonds in these secreted proteins. The precise nature of the interaction between DsbA and unfolded substrate is not known. Here, we give a detailed analysis of the DsbA crystal structure, now refined to 1.7 Angstrom, and present a proposal for its interaction with peptide. The crystal structure of DsbA implies flexibility between the thioredoxin and helical domains that may be an important feature for the disulfide transfer reaction. A hinge point for domain motion is identified-the typo IV beta-turn Phe 63-Met 64-Gly 65-Gly 66, which connects the two domains. Three unique features on the active site surface of the DsbA molecule-a groove, hydrophobic pocket, and hydrophobic patch-form an extensive uncharged surface surrounding the active-sits disulfide. Residues that contribute to these surface features are shown to be generally conserved in eight DsbA homologues. Furthermore, the residues immediately surrounding the active-site disulfide are uncharged in all nine DsbA proteins. A model for DsbA-peptide interaction has been derived from the structure of a human thioredoxin:peptide complex. This shows that peptide could interact with DsbA in a manner similar to that with thioredoxin. The active-site disulfide and all three surrounding uncharged surface features of DsbA could, in principle, participate in the binding or stabilization of peptide.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The type of surface used for running can influence the load that the locomotor apparatus will absorb and the load distribution could be related to the incidence of chronic injuries. As there is no consensus on how the locomotor apparatus adapts to loads originating from running Surfaces with different compliance, the objective of this study was to investigate how loads are distributed over the plantar surface while running on natural grass and on a rigid surface-asphalt. Forty-four adult runners with 4 3 years of running experience were evaluated while running at 12 km/h for 40 m wearing standardised running shoes and Pedar insoles (Novel). Peak pressure, contact time and contact area were measured in six regions: lateral, central and medial rearfoot, midfoot, lateral and media] forefoot. The Surfaces and regions were compared by three ANOVAS (2 x 6). Asphalt and natural grass were statistically different in all variables. Higher peak pressures were observed on asphalt at the central (p < 0.001) [grass: 303.8(66.7) kPa; asphalt: 342.3(76.3) kPa] and lateral rearfoot (p < 0.001) [grass: 312.7(75.8) kPa: asphalt: 350.9(98.3) kPa] and lateral forefoot (p < 0.001) [grass: 221.5(42.9) kPa asphalt: 245.3(55.5) kPa]. For natural grass, contact time and contact area were significantly greater at the central rearfoot (p < 0.001). These results suggest that natural grass may be a Surface that provokes lighter loads on the rearfoot and forefoot in recreational runners. (C) 2008 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Background: Versutoxin (delta-ACTX-Hv1) is the major component of the venom of the Australian Blue Mountains funnel web spider, Hadronyche versuta. delta-ACTX-Hv1 produces potentially fatal neurotoxic symptoms in primates by slowing the inactivation of voltage-gated sodium channels; delta-ACTX-Hv1 is therefore a useful tool for studying sodium channel function. We have determined the three-dimensional structure of delta ACTX-Hv1 as the first step towards understanding the molecular basis of its interaction with these channels. Results: The solution structure of delta-ACTX-Hv1, determined using NMR spectroscopy, comprises a core beta region containing a triple-stranded antiparallel beta sheet, a thumb-like extension protruding from the beta region and a C-terminal 3(10) helix that is appended to the beta domain by virtue of a disulphide bond. The beta region contains a cystine knot motif similar to that seen in other neurotoxic polypeptides. The structure shows homology with mu-agatoxin-l, a spider toxin that also modifies the inactivation kinetics of vertebrate voltage-gated sodium channels. More surprisingly, delta-ACTX-Hv1 shows both sequence and structural homology with gurmarin, a plant polypeptide. This similarity leads us to suggest that the sweet-taste suppression elicited by gurmarin may result from an interaction with one of the downstream ion channels involved in sweet-taste transduction. Conclusions: delta-ACTX-Hv1 shows no structural homology with either sea anemone or alpha-scorpion toxins, both of which also modify the inactivation kinetics of voltage-gated sodium channels by interacting with channel recognition site 3. However, we have shown that delta-ACTX-Hv1 contains charged residues that are topologically related to those implicated in the binding of sea anemone and alpha-scorpion toxins to mammalian voltage-gated sodium channels, suggesting similarities in their mode of interaction with these channels.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

BACKGROUND: Restoration of nerve continuity and effective maintenance of coaptation are considered fundamental principles of end-to-end peripheral nerve repair. OBJECTIVE: To evaluate the influence of the number of stitches on axonal regeneration and collagen production after neurorrhaphy. METHODS: Thirty male Wistar rats were equally divided into 3 groups and were all operated on with the right sciatic nerve exposed. In 2 groups, the nerve was sectioned and repaired by means of 3 (group B) or 6 (group C) epineurium sutures with 100 monofilament nylon. One group (group A) was used as a control. Each animal from groups B and C underwent electrophysiological evaluation with motor action potential recordings before nerve section and again at an 8-week interval after neurorrhaphy. Nerve biopsy specimens were used for histomorphometric assessment of axonal regeneration and quantification of collagen at the repair site. RESULTS: Animals from group C had significantly lower motor action potential conduction velocities compared with control animals (P = .02), and no significant difference was seen between groups B and C. Parameters obtained from morphometric evaluation were not significantly different between these 2 groups. Type I collagen and III collagen in the epineurium were significantly higher in group C than in either the control group (P = .001 and P = .003) or group B (P = .01 and P = .02). No differences were identified for collagen I and III in the endoneurium. CONCLUSION: Using 6 sutures for nerve repair is associated with worse electrophysiological outcomes and higher amounts of type I and III collagen in the epineurium compared with control. Neurorraphy with 6 stitches is also related to a significant increase in epineurium collagen I and III compared with 3-stitch neurorraphy.