Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Influence of salt on the self-assembly of two model amyloid heptapeptides

We study the effects of NaCl on the self-assembly of AAKLVFF and beta A beta AKLVFF in solution. Both AAKLVFF and beta A beta AKLVFF self-assemble into twisted fibers in aqueous solution. The addition of NaCl to aqueous solutions of AAKLVFF produces large crystal-like nanotapes which eventually precipitate. In contrast, highly twisted fibrils were observed for beta A beta AKLVFF solutions at low salt concentration, while a coexistence of highly twisted fibers and nanotubes was observed for beta A beta AKLVFF at high salt concentration. The self-assembled structures observed for beta A beta AKLVFF in NaCl solutions were ascribed to the progressive screening of the beta A beta AKLVFF surface charge caused by the addition of salt.

Molecular dynamics simulations of threadlike cetyltrimethylammonium chloride micelles: effects of sodium chloride and sodium salicylate salts

We use atomistic molecular dynamics simulations to probe the effects of added sodium chloride (NaCl) and sodium salicylate (NaSal) salts on the spherical-to-threadlike micelle shape transition in aqueous solutions of cetyltrimethylammonium chloride (CTAC) surfactants. Long threadlike micelles are found to be unstable and break into spherical micelles at low concentrations or NaCl, but remain stable for 20 ns above a threshold value of [NaCl] approximate to 3.0 M, which is about 2.5 times larger than the experimental salt concentration at which the transition between spherical and rodlike micelles occurs. The chloride counterions associate weakly oil the surface of the CTAC micelles with the degree of counterion dissociation decreasing slightly with increasing [NaCl] on spherical micelles, but dropping significantly on the threadlike micelles tit high [NaCl]. This effect indicates that the electrolyte ions drive the micellar shape transition by screening the electrostatic repulsions between the micellar headgroups, The aromatic salicylate counterions, on the other hand, penetrate inside the micelle with their hydrophilic groups staying in the surfactant headgroup region and the hydrophobic groups partially embedded into the hydrophobic core of the micelle. The strong association of the salicylate ions with the surfactant headgroups leads to dense packing of the surfactant molecules, which effectively reduces the surface area per surfactant, and increases intramicellar ordering of the surfactant headgroups, favoring the formation of long threadlike micelles. Simulation predictions of the geometric and electrostatic properties of the spherical and threadlike micelles are in good agreement with experiments.

Identification of components of the Sigma B Regulon in Listeria monocytogenes that contribute to acid and salt tolerance

Sigma B (σB) is an alternative sigma factor that controls the transcriptional response to stress in Listeria monocytogenes and is also known to play a role in the virulence of this human pathogen. In the present study we investigated the impact of a sigB deletion on the proteome of L. monocytogenes grown in a chemically defined medium both in the presence and in the absence of osmotic stress (0.5 M NaCl). Two new phenotypes associated with the sigB deletion were identified using this medium. (i) Unexpectedly, the strain with the ΔsigB deletion was found to grow faster than the parent strain in the growth medium, but only when 0.5 M NaCl was present. This phenomenon was independent of the carbon source provided in the medium. (ii) The ΔsigB mutant was found to have unusual Gram staining properties compared to the parent, suggesting that σB contributes to the maintenance of an intact cell wall. A proteomic analysis was performed by two-dimensional gel electrophoresis, using cells growing in the exponential and stationary phases. Overall, 11 proteins were found to be differentially expressed in the wild type and the ΔsigB mutant; 10 of these proteins were expressed at lower levels in the mutant, and 1 was overexpressed in the mutant. All 11 proteins were identified by tandem mass spectrometry, and putative functions were assigned based on homology to proteins from other bacteria. Five proteins had putative functions related to carbon utilization (Lmo0539, Lmo0783, Lmo0913, Lmo1830, and Lmo2696), while three proteins were similar to proteins whose functions are unknown but that are known to be stress inducible (Lmo0796, Lmo2391, and Lmo2748). To gain further insight into the role of σB in L. monocytogenes, we deleted the genes encoding four of the proteins, lmo0796, lmo0913, lmo2391, and lmo2748. Phenotypic characterization of the mutants revealed that Lmo2748 plays a role in osmotolerance, while Lmo0796, Lmo0913, and Lmo2391 were all implicated in acid stress tolerance to various degrees. Invasion assays performed with Caco-2 cells indicated that none of the four genes was required for mammalian cell invasion. Microscopic analysis suggested that loss of Lmo2748 might contribute to the cell wall defect observed in the ΔsigB mutant. Overall, this study highlighted two new phenotypes associated with the loss of σB. It also demonstrated clear roles for σB in both osmotic and low-pH stress tolerance and identified specific components of the σB regulon that contribute to the responses observed.

Changes in liking for a no added salt soup as a function of exposure

Multiple exposures have been shown to increase preference for novel foods or flavours. This "mere exposure" effect is also well known anecdotally for changes in preference for tastants within foods, for example reducing sugar in tea or coffee. However, to date, this phenomenon has received little scientific attention. The present study addressed this issue in relation to changes in preference for salt within soup. Following an initial assessment of liking, familiarity and saltiness of six soups varying in salt content (0 - 337 mg NaCl/ml), thirty-seven participants, previously assessed for their preferred salt level in soup, were allocated to either an exposure group that received 20 ml soup samples with no added salt, to a group that received a 280 ml bowl of this soup, or to a control group that received 20 ml soup samples containing salt at 280mg/100g (within normal, commercial range). Soups were presented on eight occasions, at approximately daily intervals. The two groups receiving the no added salt soup showed increases in liking starting at the third exposure, and also evident in a repeat assessment following the exposures. Increases in familiarity of the no added salt soup were also evident during exposure. Rated saltiness of all soups increased as a function of exposure, so a change in saltiness perception could not account for changes in liking for just the no added salt soups. These data suggest that simple exposure to the taste of the no added salt soup was sufficient to increase liking to a level equivalent to the initially more preferred salt level.

The p38-MAPK inhibitor, SB203580, inhibits cardiac stress-activated protein kinases/c-Jun N-terminal kinases (SAPKs/JNKs).

SB203580 is a recognised inhibitor of p38-MAPKs. Here, we investigated the effects of SB203580 on cardiac SAPKs/JNKs. The IC50 for inhibition of p38-MAPK stimulation of MAPKAPK2 was approximately 0.07 microM, whereas that for total SAPK/JNK activity was 3-10 microM. SB203580 did not inhibit immunoprecipitated JNK1 isoforms. Three peaks of SAPK/JNK activity were separated by anion exchange chromatography, eluting in the isocratic wash (44 kDa), and at 0.08 M (46 and 52 kDa) and 0.15 M NaCl (54 kDa). SB203580 (10 microM) completely inhibited the 0.15 M NaCl activity and partially inhibited the 0.08 M NaCl activity. Since JNK1 antibodies immunoprecipitate the 46 kDa activity, this indicates that SB203580 selectively inhibits 52 and 54 kDa SAPKs/JNKs.

Epidural analgesia with morphine or buprenorphine in ponies with lipopolysaccharide (LPS)-induced carpal synovitis

This study evaluated the analgesia effects of the epidural administration of 0.1 mg/kg bodyweight (BW) of morphine or 5 mu g/kg BW of buprenorphine in ponies with radiocarpal joint synovitis. Six ponies were submitted to 3 epidural treatments: the control group (C) received 0.15 mL/kg BW of a 0.9% sodium chloride (NaCl) solution; group M was administered 0.1 mg/kg BW of morphine; and group B was administered 5 mu g/kg BW of buprenorphine, both diluted in 0.9% NaCl to a total volume of 0.15 mL/kg BW administered epidurally at 10 s/mL. The synovitis model was induced by injecting 0.5 ng of lipopolysaccharide (LPS) in the left or right radiocarpal joint. An epidural catheter was later introduced in the lumbosacral space and advanced up to the thoracolumbar level. The treatment started 6 h after synovitis induction. Lameness, maximum angle of carpal flexion, heart rate, systolic arterial pressure, respiratory rate, temperature, and intestinal motility were evaluated before LPS injection (baseline), 6 h after LPS injection (time 0), and 0.5, 1, 2, 4, 6, 8, 10, 12, 16, 20, and 24 h after treatments. Although the model of synovitis produced clear clinical signs of inflammation, the lameness scores in group C were different from the baseline for only up to 12 h. Both morphine and buprenorphine showed a reduction in the degree of lameness starting at 0.5 and 6 h, respectively. Reduced intestinal motility was observed at 0.5 h in group M and at 0.5 to 1 h in group B. Epidural morphine was a more effective analgesic that lasted for more than 12 h and without side effects. It was concluded that morphine would be a valuable analgesic option to alleviate joint pain in the thoracic limbs in ponies.

(65)Zn(2+) transport by isolated gill epithelial cells of the American lobster, Homarus americanus

Gills are the first site of impact by metal ions in contaminated waters. Work on whole gill cells and metal uptake has not been reported before in crustaceans. In this study, gill filaments of the American lobster, Homarus americanus, were dissociated in physiological saline and separated into several cell types on a 30, 40, 50, and 80% sucrose gradient. Cells from each sucrose solution were separately resuspended in physiological saline and incubated in (65)Zn(2+) in order to assess the nature of metal uptake by each cell type. Characteristics of zinc accumulation by each kind of cell were investigated in the presence and absence of 10 mM calcium, variable NaCl concentrations and pH values, and 100 mu M verapamil, nifedipine, and the calcium ionophore A23187. (65)Zn(2+) influxes were hyperbolic functions of zinc concentration (1-1,000 mu M) and followed Michaelis-Menten kinetics. Calcium reduced both apparent zinc binding affinity (K (m)) and maximal transport velocity (J (max)) for 30% sucrose cells, but doubled the apparent maximal transport velocity for 80% sucrose cells. Results suggest that calcium, sodium, and protons enter gill epithelial cells by an endogenous broad-specificity cation channel and trans-stimulate metal uptake by a plasma membrane carrier system. Differences in zinc transport observed between gill epithelial cell types appear related to apparent affinity differences of the transporters in each kind of cell. Low affinity cells from 30% sucrose were inhibited by calcium, while high affinity cells from 80% sucrose were stimulated. (65)Zn(2+) transport was also studied by isolated, intact, gill filament tips. These intact gill fragments generally displayed the same transport properties as did cells from 80% sucrose and provided support for metal uptake processes being an apical phenomenon. A working model for zinc transport by lobster gill cells is presented.

Effects of Exercise Training on Hepatic Microsomal Triglyceride Transfer Protein Content in Rats

Microsomal triglyceride transfer protein (MTP) is a protein that exerts a central regulatory role in very-low-density lipoprotein (VLDL) assembly and secretion. The purpose of the study was to investigate the effects of all exercise-training program oil hepatic content of MTP and its relation to hepatic VLDL-triglyceride (VLDL-TG) production in response to lipid infusion. Female rats either fed a standard (SD) or all obesity-induced high-fat (HF; 43% as energy) diet for 8 weeks were Subdivided into sedentary (Sed) and trained (Tr) groups. Exercise training consisted Of Continuous running on a motor-driven rodent treadmill 5 times/week for 8 weeks. At the end of this period, all rats in the fasted state were intravenously infused with a 20% Solution of intralipid for 3 h followed by all injection of Triton WR1339 to block lipoprotein lipase. An additional control grout) consisting of Sed rats fed the SD diet was infused with saline (0.9% NaCl). Plasma TG accumulation was thereafter measured during 90 min to estimate VLDL-TG production. Under HF diet, hepatic MTP content and plasma TG accumulation after Triton blockade (thus reflecting VLDL-TG synthesis and secretion) were not changed in Sed rats, whereas liver TG content was highly increased (similar to 90%; p<0.01). Oil the other hand, training reduced liver MTP protein content in both SD(-18%) and HF(-23%) fed rats(p<0.05). Plasma VLDL-TG accumulation was also lower (p<0.05) in Tr than in Sed rats fed the HF diet. This effect was not observed in SD fed rats. Furthermore, the exercise training-induced decrease in VLDL-TG production in HF rats was associated with a decrease in liver TG levels. It is Concluded that in addition to a reduction in liver TG content, exercise training reduces VLDL synthesis and/or secretion in HF fed rats probably via MTP regulation.

Hepatic denervation impairs the assembly and secretion of VLDL-TAG

VLDL secretion is a regulated process that depends on the availability of lipids, apoB and MTP. Our aim was to investigate the effect of liver denervation upon the secretion of VLDL and the expression of proteins involved in this process. Denervation was achieved by applying a 85% phenol solution onto the portal tract, while control animals were treated with 9% NaCl. VLDL secretion was evaluated by the Tyloxapol method. The hepatic concentration of TAG and cholesterol, and the plasma concentration of TAG, cholesterol, VLDL-TAG, VLDL-cholesterol and HDL-cholesterol were measured, as well as mRNA expression of proteins involved in the process of VLDL assembly. Hepatic acinar distribution of MTP and apoB was evaluated by immunohistochemistry. Denervation increased plasma concentration of cholesterol (125.3 +/- 10.1 vs. 67.1 +/- 4.9 mg dL(-1)) and VLDL-cholesterol (61.6 +/- 5.6 vs. 29.4 +/- 3.3 mg dL(-1)), but HDL-cholesterol was unchanged (45.5 +/- 6.1 vs. 36.9 +/- 3.9 mg dL(-1)). Secretion of VLDL-TAG (47.5 +/- 23.8 vs. 148.5 +/- 27.4 mg dL h(-1)) and mRNA expression of CPT I and apoB were reduced (p < 0.01) in the denervated animals. MTP and apoB acinar distribution was not altered in the denervated animals, but the intensity of the reaction was reduced in relation to controls. Copyright (C) 2008 John Wiley & Sons, Ltd.

Effects of single or repeated amphetamine treatment and withdrawal on lung allergic inflammation in rats

The effects of single or repeated amphetamine (AMPH) treatment and those of AMPH withdrawals on immune-mediated lung inflammatory response were studied in rats. Two experiments were done. In the first, rats egg-albumin (OVA) sensitized were singularly or repeatedly (21 days, once daily) treated with AMPH (1.0 mg/kg) or with a similar number and volume of 0.9% NaCl. The OVA aerosol challenge was performed 12 h after the single or last repeated AMPH treatment and also 72 and 120 h after AMPH withdrawal. In the second experiment, the effects of reserpine (1.0 mg/kg/day for 5 consecutive days) on single AMPH actions on lung allergic response of rats were analyzed. Single and repeated AMPH treatment induced opposite actions on Bronchoalveolar lavage fluid (BAL) cellularity of allergic rats: single treatment decreased and repeated treatment increased the total number of cells as well as those of macrophages, neutrophils and eosinophils. Our data also showed that single but not repeated AMPH treatment decreased the number of neutrophils, monocytes and lymphocytes in the peripheral blood, and increased the total number of bone marrow cells in rats sensitized and challenged with OVA. Furthermore, it was shown that reserpine treatment precluded the effects of single AMPH treatment on cellular migration to the lung of OVA-sensitized and challenged rats. It was concluded that AMPH effects on lung inflammatory response and cell recruitment to the lung in allergic rats rely at least partially on corticosterone serum levels. The possible involvement of vesicular monoamine transporter type 2 (VMAT2) with these observed effects was discussed. (c) 2008 Elsevier B.V. All rights reserved.

Elastase secretion in Acanthamoeba polyphaga

Acanthamoeba species are frequently isolated from soil and water collections. In the environment, the organisms multiply as phagotrophic trophozoites and encyst under adverse conditions. Several species are known to infect man, causing keratitis and opportunistic diseases. The mechanisms underlying tissue damage and invasion by the amoebae are being elucidated and the involvement of secreted peptidases, particularly serine peptidases, has been demonstrated. Here, elastase activity was examined in Acanthamoeba-conditioned medium (ACM), making use of elastin-Congo red (ECR) and synthetic peptide p-nitroanilide substrates. ACM hydrolysed ECR over a broad pH range and optimally at a pH of 7.5 and above. Indicating the activity of serine and metallopeptidases, Congo red release was potently inhibited by PMSF, antipain, chymostatin and 1,10-phenanthroline, partially reduced by elastatinal and EDTA, and unaffected by 1,7-phenanthroline and E-64. Screening with synthetic substrates mainly showed the activity of serine peptidases. ACM efficiently hydrolysed Suc-Ala(2)-Pro-Leu-pNA and Suc-Ala(2)-Pro-Phe-pNA over a broad pH range (7.0-9.5) and was weakly active against Suc-Ala(3)-pNA, a substrate found to be optimally hydrolysed at a pH around 7.0. Following ammonium sulfate precipitation of ACM proteins and FPLC analysis, the majority of the ECR-splitting activity, characterised as serine peptidases, bound to CM-sepharose and co-eluted with part of the Suc-Ala(2)-Pro-Phe-pNA-hyd to lysing activity in a gradient of 0-0.6 M NaCl. In the corresponding FPLC fractions, serine peptidases resolving in the region of 70-130 kDa were detected in gelatin gels. Overall, the results demonstrate that trophozoites secrete elastases, and additionally suggest the high molecular weight serine peptidases as possible elastase candidates. (C) 2009 Elsevier B.V. All rights reserved.

Extensive Bilayer Perforation Coupled with the Phase Transition Region of an Anionic Phospholipid

At low ionic strength dimyristoylphosphatidylglycerol (DMPG) exhibits a broad phase transition region characterized by several superimposed calorimetric peaks. Peculiar properties, such as sample transparency, are observed only in the transition region. In this work we use differential scanning calorimetry (DSC), turbidity. and optical microscopy to study the narrowing of the transition region with the increase of ionic strength (0-500 mM NaCl). Upon addition of salt, the temperature extension of the transition region is reduced, and the number of calorimetric peaks decreases until a single cooperative event at T(m) = 23 degrees C is observed in the presence of 500 mM NaCl. The transition region is always coupled with a decrease in turbidity, but a transparent region is detected within the melting process only in the presence of up to 20 mM NaCl. The vanishing of the transparent region is associated with one of the calorimetric peaks. Optical microscopy of giant vesicles shows that bilayers first rupture when the transition region is reached and Subsequently lose optical contrast. Fluorescence microscopy reveals a blurry and undefined image in the transparent region, suggesting a different lipid self-assembly. Overall sample turbidity can be directly related to the bilayer optical contrast. Our observations are discussed in terms of the bilayer being perforated along the transition region. In the narrower temperature interval of the transparent region, dependent on the ionic strength, the perforation is extensive and the bilayer completely loses the optical contrast.

Thermal Phase Behavior of DMPG Bilayers in Aqueous Dispersions as Revealed by (2)H- and (31)P-NMR

The synthetic lipid 1,2-dimyristoyl-sn-3-phosphoglycerol (DMPG), when dispersed in water/NaCl exhibits a complex phase behavior caused by its almost unlimited swelling in excess water. Using deuterium ((2)H)- and phosphorus ((31)P)-NMR we have studied the molecular properties of DMPG/water/NaCl dispersions as a function of lipid and NaCl concentration. We have measured the order profile of the hydrophobic part of the lipid bilayer with deuterated DMPG while the orientation of the phosphoglycerol headgroup was deduced from the (31)P NMR chemical shielding anisotropy. At temperatures > 30 degrees C we observe well-resolved (2)H- and (31)P NMR spectra not much different from other liquid crystalline bilayers. From the order profiles it is possible to deduce the average length of the flexible fatty acyl chain. Unusual spectra are obtained in the temperature interval of 20-25 degrees C, indicating one or several phase transitions. The most dramatic changes are seen at low lipid concentration and low ionic strength. Under these conditions and at 25 degrees C, the phosphoglycerol headgroup rotates into the hydrocarbon layer and the hydrocarbon chains show larger flexing motions than at higher temperatures. The orientation of the phosphoglycerol headgroup depends on the bilayer surface charge and correlates with the degree of dissociation of DMPG-Na(+). The larger the negative surface charge, the more the headgroup rotates toward the nonpolar region.

On the interaction of the anthraquinone barbaloin with negatively charged DMPG bilayers

Barbaloin is a bioactive glycosilated 1,8-dihydroxyanthraquinone present in several exudates from plants, Such as Aloe vera, which are used for cosmetic or food purposes. It has been shown that barbaloin interacts with DMPG (dimyristoylphosphatidylglycerol) model membranes, altering the bilayer structure (Alves, D. S.; Perez-Fons, L.; Estepa, A.; Micol, V. Biochem. Pharm. 2004, 68, 549). Considering that ESR (electron spin resonance) of spin labels is one of the best techniques to monitor structural properties at the molecular level, the alterations caused by the anthraquinone barbaloin on phospholipid bilayers will be discussed here via the ESR signal of phospholipid spin probes intercalated into the membranes. In DMPG at high ionic strength (10 mM Hepes pH 7.4 + 100 mM NaCl), a system that presents a gel-fluid transition around 23 degrees C, 20 mol % barbaloin turns the gel phase more rigid, does not alter much the fluid phase packing, but makes the lipid thermal transition less sharp. However, in a low-salt DMPG dispersion (10 mM Hepes pH 7.4 + 2 mM NaCl), which presents a rather complex gel-fluid thermal transition (Lamy-Freund, M. T.; Riske, K. A. Chem. Phys. Lipids 2003, 122, 19), barbaloin strongly affects bilayer structural properties, both in the gel and fluid phases, extending the transition region to much higher temperature values. The position of barbaloin in DMPG bilayers will be discussed on the basis of ESR results, in parallel with data from sample viscosity, DSC (differential scanning calorimetry), and SAXS (small-angle X-ray scattering).