925 resultados para Floating bodies


Relevância:

20.00% 20.00%

Publicador:

Resumo:

To find examples of effecient locomotion and manoeuvrability, one need only turn to the elegant solutions natural flyers and swimmers have converged upon. This dissertation is specifically motivated by processes of evolutionary convergence, which have led to the propulsors and body shapes in nature that exhibit strong geometric collapse over diverse scales. These body features are abstracted in the studies presented herein using low-aspect-ratio at plates and a three-dimensional body of revolution (a sphere). The highly-separated vortical wakes that develop during accelerations are systematically characterized as a function of planform shape, aspect ratio, Reynolds number, and initial boundary conditions. To this end, force measurements and time-resolved (planar) particle image velocimetry have been used throughout to quantify the instantaneous forces and vortex evolution in the wake of the bluff bodies. During rectilinear motions, the wake development for the flat plates is primarily dependent on plate aspect ratio, with edge discontinuities and curvature playing only a secondary role. Furthermore, the axisymmetric case, i.e. the circular plate, shows strong sensitivity to Reynolds number, while this sensitivity quickly diminishes with increasing aspect ratio. For rotational motions, global insensitivity to plate aspect ratio has been observed. For the sphere, it has been shown that accelerations play an important role in the mitigation of flow separation. These results - expounded upon in this dissertation - have begun to shed light on the specific vortex dynamics that may be coopted by flying and swimming species of all shapes and sizes towards efficient locomotion.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The wave energy industry is entering a new phase of pre-commercial and commercial deployments of full-scale devices, so better understanding of seaway variability is critical to the successful operation of devices. The response of Wave Energy Converters to incident waves govern their operational performance and for many devices, this is highly dependent on spectral shape due to their resonant properties. Various methods of wave measurement are presented, along with analysis techniques and empirical models. Resource assessments, device performance predictions and monitoring of operational devices will often be based on summary statistics and assume a standard spectral shape such as Pierson-Moskowitz or JONSWAP. Furthermore, these are typically derived from the closest available wave data, frequently separated from the site on scales in the order of 1km. Therefore, variability of seaways from standard spectral shapes and spatial inconsistency between the measurement point and the device site will cause inaccuracies in the performance assessment. This thesis categorises time and frequency domain analysis techniques that can be used to identify changes in a sea state from record to record. Device specific issues such as dimensional scaling of sea states and power output are discussed along with potential differences that arise in estimated and actual output power of a WEC due to spectral shape variation. This is investigated using measured data from various phases of device development.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A novel numerical model of a Bent Backwards Duct Buoy (BBDB) Oscillating Water Column (OWC) Wave Energy Converter was created based on existing isolated numerical models of the different energy conversion systems utilised by an OWC. The novel aspect of this numerical model is that it incorporates the interdependencies of the different power conversion systems rather than modelling each system individually. This was achieved by accounting for the dynamic aerodynamic damping caused by the changing turbine rotational velocity by recalculating the turbine damping for each simulation sample and applying it via a feedback loop. The accuracy of the model was validated using experimental data collected during the Components for Ocean Renewable Energy Systems (CORES) EU FP-7 project that was tested in Galway Bay, Ireland. During the verification process, it was discovered that the model could also be applied as a valuable tool when troubleshooting device performance. A new turbine was developed and added to a full scale model after being investigated using Computational Fluid Dynamics. The energy storage capacity of the impulse turbine was investigated by modelling the turbine with both high and low inertia and applying three turbine control theories to the turbine using the full scale model. A single Maximum Power Point Tracking algorithm was applied to the low-inertia turbine, while both a fixed and dynamic control algorithm was applied to the high-inertia turbine. These results suggest that the highinertia turbine could be used as a flywheel energy storage device that could help minimize output power variation despite the low operating speed of the impulse turbine. This research identified the importance of applying dynamic turbine damping to a BBDB OWC numerical model, revealed additional value of the model as a device troubleshooting tool, and found that an impulse turbine could be applied as an energy storage system.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This paper refers to a crucial issue for higher education institutions.  In Mexico, particularly, the collective work of academic bodies is an unresolved issue despite the efforts made in this regard. In this context, a well-founded systematic discussion is essential to understand the potential of these academic bodies on faculty strengthening and their subsequent impact on the quality of education. This paper presents the results of a research project conducted by FIME  with the purpose of identifying the characteristics of its academic bodies as well as their current and potential condition. (1) Translator’s Note: FIME refers to the Facultad de Ingeniería Mecánica y Eléctrica (College of Mechanical and Electrical Engineering).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Long air gaps containing a floating conductor are common insulation types in power grids. During the transmission line live-line work, the process of lineman entering the transmission line air gap constitutes a live-line work combined air gap, which is a typical long air gap containing a floating conductor. This thesis investigates the discharge characteristics, the discharge mechanism and a discharge simulation model of long air gaps containing a floating conductor in order to address the engineering issues in live-line work. The innovative achievements of the thesis are as follows: (1) The effect of the gap distance, the floating electrode structure, the switching impulse wavefront time, the altitude, and the deviation of the floating conductor from the axis on the breakdown voltage was determined. (2) The physical process of the discharges in long air gaps containing a floating conductor was determined. The reason why the discharge characteristics of long air gaps containing a floating electrode with complex geometrics and sharp protrusions and long air gaps with a rod-shaped floating electrode are similar has been studied. The formation mechanism of the lowest breakdown voltage area of a long air gap containing a floating conductor is explained. (3) A simulation discharge model of long air gaps containing a floating conductor was established, which can describe the physical process and predict the breakdown voltage. The model can realize the accurate prediction of the breakdown voltage of typical long air gaps containing a floating conductor and live-line work combined air gaps in transmission lines. The findings of the study can provide theoretical reference and technical support for improving the safety of live-line work.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The navigation of deep space spacecraft requires accurate measurement of the probe’s state and attitude with respect to a body whose ephemerides may not be known with good accuracy. The heliocentric state of the spacecraft is estimated through radiometric techniques (ranging, Doppler, and Delta-DOR), while optical observables can be introduced to improve the uncertainty in the relative position and attitude with respect to the target body. In this study, we analyze how simulated optical observables affect the estimation of parameters in an orbit determination problem, considering the case of the ESA’s Hera mission towards the binary asteroid system composed of Didymos and Dimorphos. To this extent, a shape model and a photometric function are used to create synthetic onboard camera images. Then, using a stereophotoclinometry technique on some of the simulated images, we create a database of maplets that describe the 3D geometry of the surface around a set of landmarks. The matching of maplets with the simulated images provides the optical observables, expressed as pixel coordinates in the camera frame, which are fed to an orbit determination filter to estimate a certain number of solve-for parameters. The noise introduced in the output optical observables by the image processing can be quantified using as a metric the quality of the residuals, which is used to fine-tune the maplet-matching parameters. In particular, the best results are obtained when using small maplets, with high correlation coefficients and occupation factors.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Il presente studio mira all’esposizione della proposta di traduzione di due capitoli tratti dal saggio “Translating into Democracy” di Anna Bogic, inserito all’interno del volume “Translating Women. Different Voices and New Horizons” editato da Luise von Flotow e Farzaneh Farahzad. I capitoli in esame si intitolano rispettivamente “Our Bodies, Ourselves in the United States” e “The Politics of Translation and the ‘Other’ Europe”. Attraverso la presentazione del testo tradotto, l’elaborato riflette sul percorso editoriale di Our Bodies, Ourselves, opera di fondamentale rilevanza nata nel corso della seconda ondata femminista. Successivamente all’analisi dei contenuti del libro, il discorso fa luce sulle dinamiche di diffusione del sapere attraverso i flussi traduttivi adottando l’ottica dello schema “centro-periferia” teorizzato da Immanuel Wallerstein. Inoltre, l’elaborato propone un’analisi del testo di partenza attraverso il metodo funzionale, identificando le principali componenti che costituiscono la comunicazione testuale: il genere testuale, il mittente, lo stile linguistico e lo skopos. Successivamente, il discorso analitico individua i diversi generi di problemi traduttivi, distinguendoli in problemi pragmatici, problemi legati alle convenzioni e problemi linguistici, che vengono esplicati attraverso l’esposizione di esempi tratti direttamente dal testo originale e dalla sua versione tradotta. Infine, l’elaborato riflette sull’impatto socioculturale di “Our Bodies, Ourselves” ed evidenzia l’importanza del coordinamento femminista internazionale alla base dell’intero flusso traduttivo che ha interessato l’opera.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Caffeine has already been used as an indicator of anthropogenic impacts, especially the ones related to the disposal of sewage in water bodies. In this work, the presence of caffeine has been correlated with the estrogenic activity of water samples measured using the BLYES assay. After testing 96 surface water samples, it was concluded that caffeine can be used to prioritize samples to be tested for estrogenic activity in water quality programs evaluating emerging contaminants with endocrine disruptor activity.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Since insect species are poikilothermic organisms, they generally exhibit different growth patterns depending on the temperature at which they develop. This factor is important in forensic entomology, especially for estimating postmortem interval (PMI) when it is based on the developmental time of the insects reared in decomposing bodies. This study aimed to estimate the rates of development, viability, and survival of immatures of Sarcophaga (Liopygia) ruficornis (Fabricius 1794) and Microcerella halli (Engel 1931) (Diptera: Sarcophagidae) reared in different temperatures: 10, 15, 20, 25, 30, and 35 ± 1 °C. Bovine raw ground meat was offered as food for all experimental groups, each consisting of four replicates, in the proportion of 2 g/larva. To measure the evolution of growth, ten specimens of each group were randomly chosen and weighed every 12 h, from initial feeding larva to pupae, and then discarded. Considering the records of weight gain, survival rates, and stability of growth rates, the range of optimum temperature for the development of S. (L.) ruficornis is between 20 and 35 °C, and that of M. halli is between 20 and 25 °C. For both species, the longest times of development were in the lowest temperatures. The survival rate at extreme temperatures (10 and 35 °C) was lower in both species. Biological data such as the ones obtained in this study are of great importance to achieve a more accurate estimate of the PMI.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This work describes the evaluation of metals and (metallo)proteins in vitreous humor samples and their correlations with some biological aspects in different post-mortem intervals (1-7 days), taking into account both decomposing and non-decomposing bodies. After qualitative evaluation of the samples involving 26 elements, representative metal ions (Fe, Mg and Mo) are determined by inductively coupled plasma mass spectrometry after using mini-vial decomposition system for sample preparation. A significant trend for Fe is found with post-mortem time for decomposing bodies because of a significant increase of iron concentration when comparing samples from bodies presenting 3 and 7 days post-mortem interval. An important clue to elucidate the role of metals is the coupling of liquid chromatography with inductively coupled plasma mass spectrometry for identification of metals linked to proteins, as well as mass spectrometry for the identification of those proteins involved in the post-mortem interval.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Spores of the tropical mosses Pyrrhobryum spiniforme, Neckeropsis undulata and N. disticha were characterized regarding size, number per capsule and viability. Chemical substances were analyzed for P. spiniforme and N. undulata spores. Length of sporophyte seta (spore dispersal ability) was analyzed for P. spiniforme. Four to six colonies per species in each site (lowland and highland areas of an Atlantic Forest; Serra do Mar State Park, Brazil) were visited for the collection of capsules (2008 - 2009). Neckeropsis undulata in the highland area produced the largest spores (ca. 19 µm) with the highest viability. The smallest spores were found in N. disticha in the lowland (ca. 13 µm). Pyrrhobryum spiniforme produced more spores per capsule in the highland (ca. 150,000) than in lowland (ca. 40,000); longer sporophytic setae in the lowland (ca. 64 mm) than in the highland (ca. 43 mm); and similar sized spores in both areas (ca. 16 µm). Spores of N. undulata and P. spiniforme contained lipids and proteins in the cytoplasm, and acid/neutral lipids and pectins in the wall. Lipid bodies were larger in N. undulata than in P. spiniforme. No starch was recorded for spores. Pyrrhobryum spiniforme in the highland area, different from lowland, was characterized by low reproductive effort, but presented many spores per capsule.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A base-cutter represented for a mechanism of four bars, was developed using the Autocad program. The normal force of reaction of the profile in the contact point was determined through the dynamic analysis. The equations of dynamic balance were based on the laws of Newton-Euler. The linkage was subject to an optimization technique that considered the peak value of soil reaction force as the objective function to be minimized while the link lengths and the spring constant varied through a specified range. The Algorithm of Sequential Quadratic Programming-SQP was implemented of the program computational Matlab. Results were very encouraging; the maximum value of the normal reaction force was reduced from 4,250.33 to 237.13 N, making the floating process much less disturbing to the soil and the sugarcane rate. Later, others variables had been incorporated the mechanism optimized and new otimization process was implemented .

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Annatto seeds do not germinate during early stages of their development because of insufficient reserve substances. In situ analysis showed that the principal reserves are proteins and starch, deposited in endosperm cells. During the early stages of development, the starch grains were elliptic, because amylose was the minor component. During development, these grains became more spherical due to an increase in amylose relative to amylopectin. Endosperm cells do not contain protein bodies, but they accumulate proteins dispersed in the cytoplasm. At the final stage of development the proteins became compacted due to the dehydration of the seeds wich is part of the global process of orthodox seeds maturation. Natural fluorescence revealed aromatic amino acids, principally tryptophan and tyrosine in the proteins. The seeds reached their maximum dry weight after moisture contents had declined to around 60%. At this point the seeds presented maximum germination capacity.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Our aim was to verify the influence of a physical activities proposal in the quality of life and self image of incontinent women. This study was comparative and exploratory and was developed in 16 weeks. Thirty-seven women with and without urinary incontinence (IU) participated in the study. After the study, significant improvement in general health perception (p < 0.001), UI impact (p = 0.035), physical limitations (p = 0.015), personal relations, (p = 0.048), sleep and disposition (p = 0.012) and concerned with the gravity measurements (p = 0.011) was observed. Concerning self image, alterations in appearance were not observed; however, concerning body satisfaction, the women felt less satisfied with their bodies (p = 0.007). There was a reduction in the number of regions where they felt pain (p = 0.0003) and that they did not like (p = 0.0017). In conclusion, the Physical Education professionals using a systematized and integrated physical activities program can lead the women with IU to significant improvement in the perception of their quality of life and health concerning their self image with improvement of the IU symptoms and reduction of frequency and amount of urinary loss.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.