973 resultados para Cell-line
Resumo:
The Epstein-Barr virus-encoded nuclear antigen EBNA-1 gene promoter for the restricted Epstein-Barr virus (EBV) latency program operating in group I Burkitt lymphoma (BL) cell lines was previously identified incorrectly. Here we present evidence from RACE (rapid amplification of cDNA ends) cloning, reverse transcription-PCR, and S1 nuclease analyses, which demonstrates that the EBNA-1 gene promoter in group I BL cell lines is located in the viral BamHI Q fragment, immediately upstream of two low-affinity EBNA-1 binding sites. Transcripts initiated from this promoter, referred to as Qp, have the previously reported Q/U/K exon splicing pattern. Qp is active in group I BL cell lines but not in group III BL cell lines or in EBV immortalized B-lymphoblastoid cell lines. In addition, transient transfection of Qp-driven reporter constructs into both an EBV-negative BL cell line and a group I BL cell line gave rise to correctly initiated transcripts. Inspection of Qp revealed that it is a TATA-less promoter whose architecture is similar to the promoters of housekeeping genes, suggesting that Qp may be a default promoter which ensures EBNA-1 expression in cells that cannot run the full viral latency program. Elucidation of the genetic mechanism responsible for the EBNA-1-restricted program of EBV latency is an essential step in understanding control of viral latency in EBV-associated tumors.
Resumo:
Growth inhibition assays indicated that the IC50 values for methotrexate (MTX) and 5-fluorodeoxyuridine (FdUrd) in HS-18, a liposarcoma cell line lacking retinoblastoma protein (pRB), and SaOS-2, an osteosarcoma cell line with a truncated and nonfunctional pRB, were 10- to 12-fold and 4- to 11-fold higher, respectively, than for the HT-1080 (fibrosarcoma) cell line, which has wild-type pRB. These Rb-/- cell lines exhibited a 2- to 4-fold increase in both dihydrofolate reductase (DHFR) and thymidylate synthase (TS) enzyme activities as well as a 3- to 4-fold increase in mRNA levels for these enzymes compared to the HT-1080 (Rb+/+) cells. This increase in expression was not due to amplification of the DHFR and TS genes. Growth inhibition by MTX and FdUrd was increased and DHFR and TS activities and expression were correspondingly decreased in Rb transfectants of SaOS-2 cells. In contrast, there was no significant difference in growth inhibition among these cell lines for the nonantimetabolites VP-16, cisplatin, and doxorubicin. A gel mobility-shift assay showed that parental SaOS-2 cells had increased levels of free E2F compared to the Rb-reconstituted SaOS-2 cells. These results indicate that pRB defective cells may have decreased sensitivity to growth inhibition by target enzymes encoded by genes whose transcription is enhanced by E2F proteins and suggest mechanisms of interaction between cytotoxic agents and genes involved in cell cycle progression.
Resumo:
We investigated the relationship between the fusion selectivity of the envelope glycoprotein (env) and the tropism of different human immunodeficiency virus type 1 (HIV-1) isolates for CD4+ human T-cell lines vs. primary macrophages. Recombinant vaccinia viruses were prepared encoding the envs from several well-characterized HIV-1 isolates with distinct cytotropisms. Cells expressing the recombinant envs were mixed with various CD4+ partner cell types; cell fusion was monitored by a quantitative reporter gene assay and by syncytia formation. With CD4+ continuous cell lines as partners (T-cell lines, HeLa cells expressing recombinant CD4), efficient fusion occurred with the envs from T-cell line-tropic isolates (IIIB, LAV, SF2, and RF) but not with the envs from macrophage-tropic isolates (JR-FL, SF162, ADA, and Ba-L). The opposite selectivity pattern was observed with primary macrophages as cell partners; stronger fusion occurred with the envs from the macrophage-tropic than from the T-cell line-tropic isolates. All the envs showed fusion activity with peripheral blood mononuclear cells as partners, consistent with the ability of this cell population to support replication of all the corresponding HIV-1 isolates. These fusion selectivities were maintained irrespective of the cell type used to express env, thereby excluding a role for differential host cell modification. We conclude that the intrinsic fusion selectivity of env plays a major role in the tropism of a HIV-1 isolate for infection of CD4+ T-cell lines vs. primary macrophages, presumably by determining the selectivity of virus entry and cell fusion.
Resumo:
The T-cell receptor (TCR) beta chain is instrumental in the progression of thymocyte differentiation from the CD4-CD8- to the CD4+CD8+ stage. This differentiation step may involve cell surface expression of novel CD3-TCR complexes. To facilitate biochemical characterization of these complexes, we established cell lines from thymic lymphomas originating from mice carrying a mutation in the p53 gene on the one hand and a mutation in TCR-alpha, TCR-beta, or the recombination activating gene 1 (RAG-1) on the other hand. The cell lines were CD4+CD8+ and appeared to be monoclonal. A cell line derived from a RAG-1 x p53 double mutant thymic lymphoma expressed low levels of CD3-epsilon, -gamma, and -delta on the surface. TCR-alpha x p53 double mutant cell lines were found to express complexes consisting of TCR-beta chains associated with CD3-epsilon, -gamma, and -delta chains and CD3-zeta zeta dimers. These lines will be useful tools to study the molecular structure and signal transducing properties of partial CD3-TCR complexes expressed on the surface of immature thymocytes.
Resumo:
Predominant usage of V beta 8.2 gene segments, encoding a T-cell receptor (TCR) beta chain variable region, has been reported for pathogenic Lewis rat T cells reactive to myelin basic protein (MBP). However, up to 75% of the alpha/beta T cells in a panel of MBP-specific T-cell lines did not display TCR V beta 8.2, V beta 8.5, V beta 10, or V beta 16 elements. To further investigate TCR usage, we sorted the T-cell lines for V beta 8.2- and V beta 10-positive T cells or depleted the lines of cells with these TCRs. V beta 8.2-positive T cells and one of the depleted T-cell lines strongly reacted against the MBP peptide MBP-(68-88). The depleted T-cell line caused marked experimental autoimmune encephalomyelitis (EAE) even in Lewis rats in which endogenous V beta 8.2-positive T cells had been eliminated by neonatal treatment with anti-V beta 8.2 monoclonal antibodies. T-cell hybridomas generated from this line predominantly used V beta 3 TCR genes coexpressed with TCR V alpha 2 transcripts, which were also used by V beta 8.2-positive T cells. Furthermore, V beta 10-positive T cells reactive to MBP-(44-67) were encephalitogenic when injected immediately after positive selection. After induction of EAE by sorted V beta 8.2- or V beta 10-positive T-cell lines, immunocytochemical analysis of the spinal cord tissue showed a predominance of the injected TCR or of nontypable alpha/beta T cells after injection of the depleted line. Our results demonstrate heterogeneity of TCR beta-chain usage even for a single autoantigen in an inbred strain. Moreover, V beta 8.2-positive T cells are not essential for the induction and progression of adoptive-transfer EAE.
Resumo:
Poly(ADP-ribose) polymerase [PARP; NAD+ ADP-ribosyltransferase; NAD+:poly(adenosine-diphosphate-D-ribosyl)-acceptor ADP-D-ribosyltransferase, EC 2.4.2.30] is a zinc-dependent eukaryotic DNA-binding protein that specifically recognizes DNA strand breaks produced by various genotoxic agents. To study the biological function of this enzyme, we have established stable HeLa cell lines that constitutively produce the 46-kDa DNA-binding domain of human PARP (PARP-DBD), leading to the trans-dominant inhibition of resident PARP activity. As a control, a cell line was constructed, producing a point-mutated version of the DBD, which has no affinity for DNA in vitro. Expression of the PARP-DBD had only a slight effect on undamaged cells but had drastic consequences for cells treated with genotoxic agents. Exposure of cell lines expressing the wild-type (wt) or the mutated PARP-DBD, with low doses of N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) resulted in an increase in their doubling time, a G2 + M accumulation, and a marked reduction in cell survival. However, UVC irradiation had no preferential effect on the cell growth or viability of cell lines expressing the PARP-DBD. These PARP-DBD-expressing cells treated with MNNG presented the characteristic nucleosomal DNA ladder, one of the hallmarks of cell death by apoptosis. Moreover, these cells exhibited chromosomal instability as demonstrated by higher frequencies of both spontaneous and MNNG-induced sister chromatid exchanges. Surprisingly, the line producing the mutated DBD had the same behavior as those producing the wt DBD, indicating that the mechanism of action of the dominant-negative mutant involves more than its DNA-binding function. Altogether, these results strongly suggest that PARP is an element of the G2 checkpoint in mammalian cells.
Resumo:
Successful gene transfer into stem cells would provide a potentially useful therapeutic modality for treatment of inherited and acquired disorders affecting hematopoietic tissues. Coculture of primate bone marrow cells with retroviral producer cells, autologous stroma, or an engineered stromal cell line expressing human stem cell factor has resulted in a low efficiency of gene transfer as reflected by the presence of 0.1-5% of genetically modified cells in the blood of reconstituted animals. Our experiments in a nonhuman primate model were designed to explore various transduction protocols that did not involve coculture in an effort to define clinically useful conditions and to enhance transduction efficiency of repopulating cells. We report the presence of genetically modified cells at levels ranging from 0.1% (granulocytes) to 14% (B lymphocytes) more than 1 year following reconstitution of myeloablated animals with CD34+ immunoselected cells transduced in suspension culture with cytokines for 4 days with a retrovirus containing the glucocerebrosidase gene. A period of prestimulation for 7 days in the presence of autologous stroma separated from the CD34+ cells by a porous membrane did not appear to enhance transduction efficiency. Infusion of transduced CD34+ cells into animals without myeloablation resulted in only transient appearance of genetically modified cells in peripheral blood. Our results document that retroviral transduction of primate repopulating cells can be achieved without coculture with stroma or producer cells and that the proportion of genetically modified cells may be highest in the B-lymphoid lineage under the given transduction conditions.
Resumo:
The TCR is an alpha beta heterodimer, a part of the multimeric structure through which physiological T-cell activation occurs. The expression of TCR alpha chain is greatly diminished in a beta-chain-deficient mutant Jurkat cell line (J.RT3-T3.5). The relationship between the expression of the TCR alpha and beta chains has been examined by stable transfection of a series of TCR beta-chain mutant constructs into this mutant cell line. The level of alpha-chain transcript was dramatically upregulated by the expression of the beta chain and specifically by a transcript of the beta-chain variable region alone, including a transcript in which the ATG start codon was mutated. The downregulation of the endogenous alpha-chain transcripts in mutants cells lacking complete beta-chain transcripts occurred primarily at the posttranscriptional level. This evidence for a regulatory function of the TCR beta-chain gene represents an unusual regulatory pathway in which the transcript of one gene is required for the optimal expression of another gene.
Resumo:
We report characterization of a human T-cell lymphotropic virus type II (HTLV-II) isolated from an interleukin 2-dependent CD8 T-cell line derived from peripheral blood mononuclear cells of a healthy, HTLV-II-seropositive female Bakola Pygmy, aged 59, living in a remote equatorial forest area in south Cameroon. This HTLLV-II isolate, designated PYGCAM-1, reacted in an indirect immunofluorescence assay with HTLV-II and HTLV-I polyclonal antibodies and with an HTLV-I/II gp46 monoclonal antibody but not with HTLV-I gag p19 or p24 monoclonal antibodies. The cell line produced HTLV-I/II p24 core antigen and retroviral particles. The entire env gene (1462 bp) and most of the long terminal repeat (715 bp) of the PYGCAM-1 provirus were amplified by the polymerase chain reaction using HTLV-II-specific primers. Comparison with the long terminal repeat and envelope sequences of prototype HTLV-II strains indicated that PYGCAM-1 belongs to the subtype B group, as it has only 0.5-2% nucleotide divergence from HTLV-II B strains. The finding of antibodies to HTLV-II in sera taken from the father of the woman in 1984 and from three unrelated members of the same population strongly suggests that PYGCAM-1 is a genuine HTLV-II that has been present in this isolated population for a long time. The low genetic divergence of this African isolate from American isolates raises questions about the genetic variability over time and the origin and dissemination of HTLV-II, hitherto considered to be predominantly a New World virus.
Resumo:
Mucosal vascular addressin cell adhesion molecule 1 (MAdCAM-1) is involved in trafficking of lymphocytes to mucosal endothelium. Expression of MAdCAM-1 is induced in the murine endothelial cell line bEnd.3 by tumor necrosis factor alpha (TNF-alpha), interleukin 1, and bacterial lipopolysaccharide. Here we show that TNF-alpha enhances expression of a firefly luciferase reporter directed by the MAdCAM-1 promoter, confirming transcriptional regulation of MAdCAM-1. Mutational analysis of the promoter indicates that a DNA fragment extending from nt -132 to nt +6 of the gene is sufficient for TNF-alpha inducibility. Two regulatory sites critical for TNF-alpha induction were identified in this region. DNA-binding experiments demonstrate that NF-kappa B proteins from nuclear extracts of TNF-alpha-stimulated bEnd.3 cells bind to these sites, and transfection assays with promoter mutants of the MAdCAM-1 gene indicate that occupancy of both sites is essential for promoter function. The predominant NF-kappa B binding activity detected with these nuclear extracts is a p65 homodimer. These findings establish that, as with other endothelial cell adhesion molecules, transcriptional induction of MAdCAM-1 by TNF-alpha requires activated NF-kappa B proteins.
Resumo:
Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.
Resumo:
Tumour progression is a complex process that frequently brings to cancer metastasis, the first cause of poor prognosis of cancer affected patients. Metastasis are generated by cells escaped from a primary mass and able to enter in the circulation, survive and proliferate in a new, distant site of the organism. To reach all these goal, many different phenomena had occur within both the cancer cells and the surrounding microenvironment. In the first part of this thesis, the focus was pointed on the metastatic potential of a leiomyosarcoma cell model. The studied cancer cells demonstrated a strong invasive capacity of the ECM in vitro, principally by production of matrix metalloproteinases 2 and 9, and robust pro-angiogenic activity in the chick CAM model, that facilitate its dissemination through same chick embryo internal organs. This study, with the title “MMPs and angiogenesis affect the metastatic potential of a human vulvar leiomyosarcoma cell line”, is presented in the published form. In the second part of this work, the emphasis was given to the microvascular element of the tumour microenvironment and specifically to the perivascular pericytes. These are intriguing cells due to their uncertain involvement in the biology of cancer. It is not clear how pericytes change within the tumour microenvironment and which is their contribute during the tumour dissemination. After the characterization of the chosen pericytic cell model, an in vitro study of the interaction between pericytes and different cancer cell lines where performed. Indirect and direct cell-cell interaction as well as movement of cancer cells in presence of pericytes conditioned media was analysed, in order to investigate the reciprocal influence of pericytes and tumour cells in the context of cancer progression.
Resumo:
Trabalho Final do Curso de Mestrado Integrado em Medicina, Faculdade de Medicina, Universidade de Lisboa, 2014
Resumo:
Afin d’effectuer des études fonctionnelles sur le génome de la souris, notre laboratoire a généré une bibliothèque de clones de cellules souches embryonnaires (ESC) présentant des suppressions chromosomiques chevauchantes aléatoires – la bibliothèque DELES. Cette bibliothèque contient des délétions couvrant environ 25% du génome murin. Dans le laboratoire, nous comptons identifier de nouveaux déterminants du destin des cellules hématopoïétiques en utilisant cet outil. Un crible primaire utilisant la benzidine pour démontrer la présence d'hémoglobine dans des corps embryoïdes (EBS) a permis d’identifier plusieurs clones délétés présentant un phénotype hématopoïétique anormal. Comme cet essai ne vérifie que la présence d'hémoglobine, le but de mon projet est d'établir un essai in vitro de différenciation des ESC permettant de mesurer le potentiel hématopoïétique de clones DELES. Mon hypothèse est que l’essai de différenciation hématopoïétique publié par le Dr Keller peut être importé dans notre laboratoire et utilisé pour étudier l'engagement hématopoïétique des clones DELES. À l’aide d’essais de RT-QPCR et de FACS, j’ai pu contrôler la cinétique de différenciation hématopoïétique en suivant l’expression des gènes hématopoïétiques et des marqueurs de surface comme CD41, c-kit, RUNX1, GATA2, CD45, β-globine 1 et TER-119. Cet essai sera utilisé pour valider le potentiel hématopoïétique des clones DELES candidats identifiés dans le crible principal. Mon projet secondaire vise à utiliser la même stratégie rétro-virale a base de Cre-loxP utilisée pour générer la bibliothèque DELES pour générer une bibliothèque de cellules KBM-7 contenant des suppressions chromosomiques chevauchantes. Mon but ici est de tester si la lignée cellulaire leuémique humaine presque haploïde KBM-7 peut être exploitée en utilisant l'approche DELES pour créer cette bibliothèque. La bibliothèque de clones KBM-7 servira à définir les activités moléculaires de drogues anti-leucémiques potentielless que nous avons identifiées dans le laboratoire parce qu’elles inhibent la croissance cellulaire dans plusieurs échantillons de leucémie myéloïde aiguë dérivés de patients. Elle me permettra également d'identifier les voies de signalisation moléculaires qui, lorsque génétiquement perturbées, peuvent conférer une résistance à ces drogues.
Resumo:
Description based on: 7th ed. (1980)