The Relationship Among Resilience, Forgiveness, and Anger Expression in Adolescents

This study was designed to investigate and describe the relationship among resilience, forgiveness and anger expression in adolescents. The purpose of the study was to explore whether certain adolescent resiliencies significantly related to positive or negative affective, behavioral, or cognitive levels of forgiveness and certain types of anger expression in adolescents. This study also investigated whether there were certain adolescent resiliencies and types of forgiveness that can predict lower levels of negative anger expression in adolescents. This research was built on two conceptual models: Wolin and Wolin's (1993) Challenge Model and the Forgiveness Process Model (Enright & Human Development Study Group, 1991). It was based on a quantitative, single-subject correlational research design. A multiple regression analysis was also used to explore possible effects of resilience and forgiveness on anger expression in adolescents. In addition, two demographic variables, Age and Gender, were examined for possible effects on anger expression. Data were gathered from a convenience sample sample of 70 students in three Maine public high schools using three separate assessment instruments: the Adolescent Resiliency Attitudes Scale (ARAS), the Adolescent Version of the Enright Forgiveness Inventory (EFI), and the Adolescent Anger Rating Scale (AARS). Correlational analyses were done on the scales and subscales of these surveys. Significant relationships were found between several adolescent resiliencies and forms of forgiveness as well as between some adolescent resiliencies and types of anger expression. The data indicated that Total Resiliency significantly correlated with Total Forgiveness as well as Total Anger. The findings also identified particular adolescent resiliencies that significantly predicted types of anger expression, while forgiveness did not predict types of anger expression. The data revealed that Age and Gender had no significant affect on anger expression. These findings suggest that the constructs of adolescent resilience and forgiveness have commonalities that can influence how adolescents express anger, and further suggest that intervention and prevention programs expand their focus to incorporate forgiveness skills. The findings from this study can provide critical information to counselors, therapists, and other helping professionals working with adolescents, on approaches to designing and implementing therapy modalities or developmental school guidance programs for adolescents.

The Acceleration of Stock Options in Anticipation of FAS 123 (R)

The Financial Accounting Standards Board (FASB) mandated the expensing of stock options with FAS 123 (R). As of March 2006, 749 companies had accelerated the vesting of their employee stock options and avoided a reduction in their reported profits that otherwise would have occurred under the new standard. There are many different motives for the acceleration strategy, and the focus of this study is to determine whether shareholders viewed these motives as either positive or negative. A favorable return subsequent to an acceleration announcement would signify that shareholder's viewed management's motives as positive. An unfavorable return subsequent to an acceleration announcement would signify that shareholder's viewed management's motives as negative. The evidence from this study suggests that shareholders reacted favorably, on average, to acceleration announcements. However, these results lack statistical significance and are based on a small sample, thus, they should be interpreted with caution.

Zoning and the built environment: A public health analysis of zoning in Austin, Texas

The built environment is part of the physical environment made by people and for people. Because the built environment is such a ubiquitous component of the environment, it acts as an important pathway in determining health outcomes. Zoning, a type of urban planning policy, is one of the most important mechanisms connecting the built environment to public health. This policy analysis research paper explores how zoning regulations in Austin, Texas promote or prohibit the development of a healthy built environment. A systematic literature review was obtained from Active Living Research, which contained literature published about the relationships between the built environment, physical activity, and health. The results of these studies identified the following four components of the built environment that were associated to health: access to recreational facilities, sprawl and residential density, land use mix, and sidewalks and their walkability. A hierarchy analysis was then performed to demonstrate the association between these aspects of the built environment and health outcomes such as obesity, cardiovascular disease, and general health. Once these associations had been established, the components of the built environment were adapted into the evaluation criteria used to conduct a public health analysis of Austin's zoning ordinance. A total of eighty-eight regulations were identified to be related to these components and their varying associations to human health. Eight regulations were projected to have a negative association to health, three would have both a positive and negative association simultaneously, and nine were indeterminable with the information obtained through the literature review. The remaining sixty-eight regulations were projected to be associated in a beneficial manner to human health. Therefore, it was concluded that Austin's zoning ordinance would have an overwhelmingly positive impact on the public's health based on identified associations between the built environment and health outcomes.^

Sex, drugs, and STIs: Syphilis infection and hepatitis B vaccine compliance among illicit drug users in Houston

Although the association between syphilis infection status and compliance with the hepatitis B virus vaccine has been the focus of investigation, there is a lack of data regarding the association between syphilis infection and HBV vaccine compliance. The author investigated the association between the exposure of syphilis infection and the outcome of HBV vaccine completion, defined as degree of constancy and accuracy with which a patient follows a prescribed regimen. A cohort design was employed using interview and serological data from the Drugs, AIDS, STDs, Hepatitis (DASH) Research Project; analysis was restricted to HIV and HBV seronegative (at baseline), illicit drug users residing in Harris County. Syphilis negative and syphilis positive infection status was determined from the serological data while covariates and outcome information were determined from the DASH Project Questionnaire; enrolled subjects (n=1160) were selected from the data. Association between exposure and outcome was assessed with logistic regression adjusted for data-based confounders. ^ A prevalence of 7% and 71% was found for syphilis and HBV vaccine compliance, respectively. When measuring the actual association between syphilis infection status and HBV vaccine compliance, an odds ratio of 1.49 (95% CI: 0.86, 2.72) was obtained. There was a non-significant association between these two variables. 78% of the study population was syphilis positive and completed the vaccine series compared to 70% of the population that was syphilis negative and received all three doses. This finding confirms that there is a difference between syphilis positive and negative drug users with respect to HBV vaccine compliance. The fact that differences were found in these drug users with respect to vaccine schedule supports the idea that sub-group differences may exist and thus merits further investigation. If these differences are confirmed, it is recommended that STI interventions identify community characteristics of their samples and target populations based on practices specific to that community. ^

A screening for anti-West Nile immunoglobulin-G and immunoglobulin-M in the Cameron County Hispanic cohort

This study is designed to be a cross-sectional, retrospective analysis of the seroprevalence of anti-WNV antibodies in 1,006 plasma samples collected from February 2, 2006 to June 18, 2007 originally for The Cameron County Hispanic Cohort: Extreme obesity and uncontrolled diabetes on the U.S.-Mexico border, major concerns for populations with health disparities. The aim of this thesis research is to give a more up-to-date picture of Flavivirus activity in south Texas, which can potentially contribute to the surveillance objective of arboviral control in this area. A West Nile virus (WNV) seroprevalence study in humans in this particular area has never before been completed. Plasma samples were tested using immunoglobulin-G (IgG) and immunoglobulin-M (IgM) WNV enzyme linked immunosorbent assays (ELISA). Estimated seroprevalence for this particular population was 0.98% or 9.8 cases of West Nile disease per 1,000 citizens. After IgG testing, seroprevalence in the study population was found to be 15.4%. Specimens tested for WNV IgG were compared with a subset of specimens (N=803) tested for history of primary dengue virus (DENV) infection. Of the 803 specimens tested for IgG to DENV, 308 were positive. Of the 132 positive WNV IgG specimens in the subset, 131 (99.2%) tested also tested positive for DENV IgG. It would be helpful to use standard plaque reduction neutralization testing to determine if the seroprevalence is in fact lower because of cross-reaction to DENV on testing. Regardless of the possibility of other Flavivirus activity occurring prior to the introduction of WNV into the United States and the potential for cross-reactivity, Texas has ranked in the top 5 states with the highest, laboratory confirmed incidence of infection with WNV since 2003. Indicating that climate factors and the presence of suitable vectors makes Texas a hotspot for WNV activity. ^ A description of the study population by age, gender, and income was done indicating a statistically significant income difference with a mean household income per year being $13,413.55 for a case and $20,268.80 for non-cases (p=0.001). Lower income neighborhoods should be targeted for education and prevention of vector-borne diseases during the summer months in Cameron County. With respect to gender, being male has been noted in the literature to be a risk factor for infection with WNV (25). In this study, females comprised approximately 68% of the study population, they also made up 66.5% of the positive IgG specimens. An odds ratio of 0.91 indicates that women are less likely to be IgG positive for WNV as compared to men; however, this was not found to be significant based on the 95% confidence interval, but is consistent with the literature. When looking at age difference between positive and negative/equivocal cases, there was no statistical difference found between the two groups. ^ We concluded that this study will enable us to understand the epidemiology of WNV transmission since its introduction into the United States and hopefully to maintain or improve the current measures we have in place to prevent infections that are seen annually with WNV.^

Attitudes About Predictive MEN1 Genetic Testing in Minors

Multiple Endocrine Neoplasia type 1 (MEN1) is a hereditary cancer syndrome characterized by tumors of the endocrine system. Tumors most commonly develop in the parathyroid glands, pituitary gland, and the gastro-entero pancreatic tract. MEN1 is a highly penetrant condition and age of onset is variable. Most patients are diagnosed in early adulthood; however, rare cases of MEN1 present in early childhood. Expert consensus opinion is that predictive genetic testing should be offered at age 5 years, however there are no evidence-based studies that clearly establish that predictive genetic testing at this age would be beneficial since most symptoms do not present until later in life. This study was designed to explore attitudes about the most appropriate age for predictive genetic testing from individuals at risk of having a child with MEN1. Participants who had an MEN1 mutation were invited to complete a survey and were asked to invite their spouses to participate as well. The survey included several validated measures designed to assess participants’ attitudes about predictive testing in minors. Fifty-eight affected participants and twenty-two spouses/partners completed the survey. Most participants felt that MEN1 genetic testing was appropriate in healthy minors. Younger age and increased knowledge of MEN1 genetics and inheritance predicted genetic testing at a younger age. Additionally, participants who saw more positive than negative general outcomes from genetic testing were more likely to favor genetic testing at younger ages. Overall, participants felt genetic testing should be offered at a younger age than most adult onset conditions and most felt the appropriate time for testing was when a child could understand and participate in the testing process. Psychological concerns seemed to be the primary focus of participants who favored later ages for genetic testing, while medical benefits were more commonly cited for younger age. This exploratory study has implications for counseling patients whose children are at risk of developing MEN1 and illustrates issues that are important to patients and their spouses when considering testing in children.

DETERMINING THE GENOTYPE-PHENOTYPE CONNECTION IN SYNTHETIC INDUCIBLE GENE EXPRESSION SYSTEMS

Introduction Gene expression is an important process whereby the genotype controls an individual cell’s phenotype. However, even genetically identical cells display a variety of phenotypes, which may be attributed to differences in their environment. Yet, even after controlling for these two factors, individual phenotypes still diverge due to noisy gene expression. Synthetic gene expression systems allow investigators to isolate, control, and measure the effects of noise on cell phenotypes. I used mathematical and computational methods to design, study, and predict the behavior of synthetic gene expression systems in S. cerevisiae, which were affected by noise. Methods I created probabilistic biochemical reaction models from known behaviors of the tetR and rtTA genes, gene products, and their gene architectures. I then simplified these models to account for essential behaviors of gene expression systems. Finally, I used these models to predict behaviors of modified gene expression systems, which were experimentally verified. Results Cell growth, which is often ignored when formulating chemical kinetics models, was essential for understanding gene expression behavior. Models incorporating growth effects were used to explain unexpected reductions in gene expression noise, design a set of gene expression systems with “linear” dose-responses, and quantify the speed with which cells explored their fitness landscapes due to noisy gene expression. Conclusions Models incorporating noisy gene expression and cell division were necessary to design, understand, and predict the behaviors of synthetic gene expression systems. The methods and models developed here will allow investigators to more efficiently design new gene expression systems, and infer gene expression properties of TetR based systems.

Indeterminate QunatiFERON-TB Gold In-Tube assay results in association with procedural specimen collection in children

BACKGROUND. The development of interferon-gamma release assays (IGRA) has introduced powerful tools in diagnosing latent tuberculosis infection (LTBI) and may play a critical role in the future of tuberculosis diagnosis. However, there have been reports of high indeterminate results in young patient populations (0-18 years). This study investigated results of the QunatiFERON-TB Gold In-Tube (QFT-GIT) IGRA in a population of children (0-18 years) at Texas Children's Hospital in association with specimen collection procedures using surrogate variables. ^ METHODS. A retrospective case-control study design was used for this investigation. Cases were defined as having QFT-GIT indeterminate results. Controls were defined as having either positive or negative results (determinates). Patients' admission status, staff performing specimen collection, and specific nurse performing specimen collection were used as surrogates to measure specimen collection procedures. ^ To minimize potential confounding, abstraction of patients' electronic medical records was performed. Abstracted data included patients' medications and evaluation at the time of QFT-GIT specimen collection in addition to their medical history. QFT-GIT related data was also abstracted. Cases and controls were characterized using chi-squared tests or Fisher's exact tests across categorical variables. Continuous variables were analyzed using one-way ANOVA and t-tests for continuous variables. A multivariate model was constructed by backward stepwise removal of statistically significant variables from univariate analysis. ^ RESULTS. Patient data was abstracted from 182 individuals aged 0-18 years from July 2010 to August 2011 at Texas Children's Hospital. 56 cases (indeterminates) and 126 controls (determinates) were enrolled. Cancer was found to be an effect modifier with subsequent stratification resulting in a cancer patient population too small to analyze (n=13). Subsequent analyses excluded these patients. ^ The exclusion of cancer patients resulted in a population of 169 patients with 49 indeterminates (28.99%) and 120 determinates (71.01%), with mean ages of 9.73 (95% CI: 8.03, 11.43) years and 11.66 (95% CI: 10.75, 12.56) years (p = 0.033), respectively. Median age of patients who were indeterminates and determinates were 12.37 and 12.87 years, respectively. Lack of data for our specific nurse surrogate (QFTNurse) resulted in its exclusion from analysis. The final model included only our remaining surrogate variables (QFTStaff and QFTInpatientOutpatient). The staff collecting surrogate (QFTStaff) was found to be modestly associated with indeterminates when nurses collected the specimen (OR = 1.54, 95% CI: 0.51, 4.64, p = 0.439) in the final model. Inpatients were found to have a strong and statistically significant association with indeterminates (OR = 11.65, 95% CI: 3.89, 34.9, p < 0.001) in the final model. ^ CONCLUSION. Inpatient status was used as a surrogate for indication of nurse drawn blood specimens. Nurses have had little to no training regarding shaking of tubes versus phlebotomists regarding QFT-GIT testing procedures. This was also measured by two other surrogates; specifically a medical note stating whether a nurse or phlebotomist collected the specimen (QFTStaff) and the name and title of the specific nurse if collection was performed by a nurse (QFTNurse). Results indicated that inpatient status was a strong and statistically significant factor for indeterminates, however, nurse collected specimens and indeterminate results had no statistically significant association in non-cancer patients. The lack of data denoting the specific nurse performing specimen collection excluded the QFTNurse surrogate in our analysis. ^ Findings suggests training of staff personnel in specimen procedures may have little effect on the number of indeterminates while inpatient status and thus possibly illness severity may be the most important factor for indeterminate results in this population. The lack of congruence between our surrogate measures may imply that our inpatient surrogate gauged illness severity rather than collection procedures as intended. ^ Despite the lack of clear findings, our analysis indicated that more than half of indeterminates were found in specimens drawn by nurses and as such staff training may be explored. Future studies may explore methods in measuring modifiable variables during pre-analytical QFT-GIT procedures that can be discerned and controlled. Identification of such measures may provide insight into ways to lowering indeterminate QFT-GIT rates in children.^

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Subjective well -being as predictor of mortality, heart disease, and obesity: Prospective evidence from the Alameda County Study

Based on the World Health Organization's (1965) definition of health, understanding of health requires understanding of positive psychological states. Subjective Well-being (SWB) is a major indicator of positive psychological states. Up to date, most studies of SWB have been focused on its distributions and determinants. However, study of its consequences, especially health consequences, is lacking. This dissertation research examined Subjective Well-being, as operationally defined by constructs drawn from the framework of Positive Psychology, and its sub-scores (Positive Feelings and Negative Feelings) as predictors of three major health outcomes—mortality, heart disease, and obesity. The research used prospective data from the Alameda County Study over 29 years (1965–1994), based on a stratified, randomized, representative sample of the general public in Alameda County, California (Baseline N = 6928). ^ Multivariate analyses (Survival analyses using sequential Cox Proportional Hazard models in the cases of mortality and heart disease, and sequential Logistic Regression analyses in the case of obesity) were performed as the main methods to evaluate the associations of the predictors and the health outcomes. The results revealed that SWB reduced risks of all-cause mortality, natural-cause mortality, and cardiovascular mortality. Positive feelings not only had an even stronger protective effect against all-cause, natural-cause and cardiovascular mortality, but also predicted decreased unnatural-cause mortality which includes deaths from suicide, homicide, accidents, mental disorders, drug dependency, as well as alcohol-related liver diseases. These effects were significant even after adjusted for age, gender, education, and various physical health measures, and, in the case of cardiovascular mortality, obesity and health practices (alcohol consumption, smoking, and physical activities). However, these two positive psychological indicators, SWB and positive feelings, did not predict obesity. And negative feelings had no significant effect on any of the health outcomes evaluated, i.e., all-cause mortality, natural- and unnatural-cause mortality, cardiovascular mortality, or obesity, after covariates were controlled. These findings were discussed (1) in comparison with relevant existing studies, (2) in terms of their implications in health research and promotion, (3) in terms of the independence of positive and negative feelings, and (4) from a Positive Psychology perspective and its significance in Public Health research and practice. ^

Actividad biológica de Lonchocarpus guaricensis Pittier en el control de larvas de Tuta absoluta (Meyrick)

La actividad biológica de Lonchocarpus guaricensis Pittier fue evaluada utilizando dos dosis de Tecnona® en el control de larvas de Tuta absoluta (Meyrick), Valle de Azapa, Chile, mediante una pulverización sobre plantas de tomate cv. Naomi en macetas, ubicadas aleatoriamente en un invernáculo dentro de un vivero. Semanas previas a la pulverización, las macetas se infestaron artificialmente con adultos del fitófago para obtener larvas en los foliolos. Los tratamientos evaluados fueron los siguientes: T1 (0,21 g de IA de L. guaricensis·L-1), T2 (0,43 g de IA de L. guaricensis·L-1), T3 (control positivo a base de spinosad 0,048 g de IA·L-1) y T0 (control negativo a base de agua de pozo). De acuerdo con el porcentaje de mortalidad acumulada de larvas contabilizadas a las 24, 48, 120 horas y 9no día post aplicación, no hay diferencias estadísticas entre los tratamientos T0 y T1, a su vez, T2 alcanza una media de 53,05% de mortalidad, no diferenciándose de T3 que logra un 73,9%. Se concluye que la dosis experimental L. guaricensis de 0,43 g de IA∙ L-1 puede constituir una alternativa interesante de utilizar en el Manejo Integrado de Plagas del cultivo de tomate en el Valle de Azapa.

Automated Tools for Layer Recognition (BMPix) and Counting (PEAK)

We present tools for rapid and quantitative detection of sediment lamination. The BMPix tool extracts color and gray-scale curves from images at pixel resolution. The PEAK tool uses the gray-scale curve and performs, for the first time, fully automated counting of laminae based on three methods. The maximum count algorithm counts every bright peak of a couplet of two laminae (annual resolution) in a smoothed curve. The zero-crossing algorithm counts every positive and negative halfway-passage of the curve through a wide moving average, separating the record into bright and dark intervals (seasonal resolution). The same is true for the frequency truncation method, which uses Fourier transformation to decompose the curve into its frequency components before counting positive and negative passages. We applied the new methods successfully to tree rings, to well-dated and already manually counted marine varves from Saanich Inlet, and to marine laminae from the Antarctic continental margin. In combination with AMS14C dating, we found convincing evidence that laminations in Weddell Sea sites represent varves, deposited continuously over several millennia during the last glacial maximum. The new tools offer several advantages over previous methods. The counting procedures are based on a moving average generated from gray-scale curves instead of manual counting. Hence, results are highly objective and rely on reproducible mathematical criteria. Also, the PEAK tool measures the thickness of each year or season. Since all information required is displayed graphically, interactive optimization of the counting algorithms can be achieved quickly and conveniently.

Spatial spillover effects in determining China's regional CO2 emission growth : 2007-2010

This paper proposes an alternative input-output based spatial-structural decomposition analysis to elucidate the role of domestic-regional heterogeneity and interregional spillover effects in determining China's regional CO2 emission growth. Our empirical results based on the 2007 and 2010 Chinese interregional input-output tables show that the changes in most regions' final demand scale, final expenditure structure and export scale give positive spatial spillover effects on other regions' CO2 emission growth, the changes in most regions' consumption and export preference help the reduction of other regions' CO2 emissions, the changes in production technology, and investment preference may give positive or negative impacts on other region's CO2 emission growth through domestic supply chains. For some regions, the aggregate spillover effect from other regions may be larger than the intra-regional effect in determining regional emission growth. All these facts can significantly help better and deeper understanding on the driving forces of China's regional CO2 emission growth, thus can enrich the policy implication concerning a narrow definition of "carbon leakage" through domestic-interregional trade, and relevant political consensus about the responsibility sharing between developed and developing regions inside China.

Seismic modelling and ava analysis of hidrocarbon traps

In this study, forward seismic modelling of four geological models with Hydrocarbon (HC) traps were performed by ray tracing method to produce synthetic seismogram of each model. The idea is to identify the Hydrocarbon Indicators (HCI‟s) such as bright spot, flat spot, dim spot and Bottom Simulating Reflector (BSR) in the synthethic seismogram. The modelling was performed in DISCO/FOCUS 5.0 seismic data processing programme. Strong positive and negative reflection amplitudes and some artifact reflection horizons were observed on produced seismograms due to rapid changes in subsurface velocity and geometry respectively Additionally, Amplitude-versus-angle (AVA) curves of each HCIs was calculated by the Crewes Zoeppritz Explorer programme. AVA curves show that how the reflection coefficients change with the density and the P and S wave velocities of each layer such as oil, gas, gas hydrate or water saturated sediments. Due to AVA curves, an increase in reflection amplitude with incident angle of seismic waves corresponds to an indicator of a hydrocarbon reservoir

A Model of Emotion as Patterned Metacontrol

Adaptive agents use feedback as a key strategy to cope with un- certainty and change in their environments. The information fed back from the sensorimotor loop into the control subsystem can be used to change four different elements of the controller: parameters associated to the control model, the control model itself, the functional organization of the agent and the functional realization of the agent. There are many change alternatives and hence the complexity of the agent’s space of potential configurations is daunting. The only viable alternative for space- and time-constrained agents —in practical, economical, evolutionary terms— is to achieve a reduction of the dimensionality of this configuration space. Emotions play a critical role in this reduction. The reduction is achieved by func- tionalization, interface minimization and by patterning, i.e. by selection among a predefined set of organizational configurations. This analysis lets us state how autonomy emerges from the integration of cognitive, emotional and autonomic systems in strict functional terms: autonomy is achieved by the closure of functional dependency. Emotion-based morphofunctional systems are able to exhibit complex adaptation patterns at a reduced cognitive cost. In this article we show a general model of how emotion supports functional adaptation and how the emotional biological systems operate following this theoretical model. We will also show how this model is also of applicability to the construction of a wide spectrum of artificial systems1.