942 resultados para intracellular staining


Relevância:

10.00% 10.00%

Publicador:

Resumo:

The parasympathetic nervous system is important for β-cell secretion and mass regulation. Here, we characterized involvement of the vagus nerve in pancreatic β-cell morphofunctional regulation and body nutrient homeostasis in 90-day-old monosodium glutamate (MSG)-obese rats. Male newborn Wistar rats received MSG (4 g/kg body weight) or saline [control (CTL) group] during the first 5 days of life. At 30 days of age, both groups of rats were submitted to sham-surgery (CTL and MSG groups) or subdiaphragmatic vagotomy (Cvag and Mvag groups). The 90-day-old MSG rats presented obesity, hyperinsulinemia, insulin resistance, and hypertriglyceridemia. Their pancreatic islets hypersecreted insulin in response to glucose but did not increase insulin release upon carbachol (Cch) stimulus, despite a higher intracellular Ca2+ mobilization. Furthermore, while the pancreas weight was 34% lower in MSG rats, no alteration in islet and β-cell mass was observed. However, in the MSG pancreas, increases of 51% and 55% were observed in the total islet and β-cell area/pancreas section, respectively. Also, the β-cell number per β-cell area was 19% higher in MSG rat pancreas than in CTL pancreas. Vagotomy prevented obesity, reducing 25% of body fat stores and ameliorated glucose homeostasis in Mvag rats. Mvag islets demonstrated partially reduced insulin secretion in response to 11.1 mM glucose and presented normalization of Cch-induced Ca2+ mobilization and insulin release. All morphometric parameters were similar among Mvag and CTL rat pancreases. Therefore, the higher insulin release in MSG rats was associated with greater β-cell/islet numbers and not due to hypertrophy. Vagotomy improved whole body nutrient homeostasis and endocrine pancreatic morphofunction in Mvag rats.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

To characterize the relaxation induced by the soluble guanylate cyclase (sGC) activator, BAY 60-2770 in rabbit corpus cavernosum. Penis from male New Zealand rabbits were removed and fours strips of corpus cavernosum (CC) were obtained. Concentration-response curves to BAY 60-2770 were carried out in the absence and presence of inhibitors of nitric oxide synthase, L-NAME (100 μM), sGC, ODQ (10 μM) and phosphodiestarase type 5, tadalafil (0.1 μM). The potency (pEC50) and maximal response (Emax) values were determined. Second, electrical-field stimulation (EFS)-induced contraction or relaxation was realized in the absence and presence of BAY 60-2770 (0.1 or 1 μM) alone or in combination of ODQ (10 μM). In the case of EFS-induced relaxation two protocols were realized: 1) ODQ (10 μM) was first incubated for 20 min and then BAY 60-2770 (1 μM) was added for another 20 min (ODQ + BAY 60-2770). In different CC strips, BAY 60-2770 was incubated for 20 min followed by another 20 min with ODQ (BAY 60-2770 + ODQ). The intracellular levels of cyclic guanosine monophosphate (cGMP) were also determined. BAY 60-2770 potently relaxed rabbit CC with pEC50 and Emax values of 7.58 ± 0.19 and 81 ± 4%, respectively. The inhibitors ODQ (n=7) or tadalafil (n=7) produced 4.2- and 6.3-leftward shifts, respectively in BAY 60-2770-induced relaxation without interfering on the Emax values. The intracellular levels of cGMP were augmented after stimulation with BAY 60-2770 (1 μM) alone, whereas its co-incubation with ODQ produced even higher levels of cGMP. The EFS-induced contraction was reduced in the presence of BAY 60-2770 (1 μM) and this inhibition was even greater when BAY 60-2770 was co-incubated with ODQ. The nitrergic stimulation induced CC relaxation, which was abolished in the presence of ODQ. BAY 60-2770 alone increased the amplitude of relaxation. Co-incubation of ODQ and BAY 60-2770 did not alter the relaxation in comparison with ODQ alone. Interestingly, when BAY 60-2770 was incubated prior to ODQ, EFS-induced relaxation was partly restored in comparison with ODQ alone or ODQ + BAY 60-2770. Considering that the relaxation induced by the sGC activator, BAY 60-2770 was increased after sGC oxidation and unaltered in the absence of nitric oxide, these class of substances are advantageous over sGC stimulators or PDE5 inhibitors for the treatment in those patients with erectile dysfunction and high endothelial damage. This article is protected by copyright. All rights reserved.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Calcium dynamics is central in cardiac physiology, as the key event leading to the excitation-contraction coupling (ECC) and relaxation processes. The primary function of Ca(2+) in the heart is the control of mechanical activity developed by the myofibril contractile apparatus. This key role of Ca(2+) signaling explains the subtle and critical control of important events of ECC and relaxation, such Ca(2+) influx and SR Ca(2+) release and uptake. The multifunctional Ca(2+)-calmodulin-dependent protein kinase II (CaMKII) is a signaling molecule that regulates a diverse array of proteins involved not only in ECC and relaxation, but also in cell death, transcriptional activation of hypertrophy, inflammation and arrhythmias. CaMKII activity is triggered by an increase in intracellular Ca(2+) levels. This activity can be sustained, creating molecular memory after the decline in Ca(2+) concentration, by autophosphorylation of the enzyme, as well as by oxidation, glycosylation and nitrosylation at different sites of the regulatory domain of the kinase. CaMKII activity is enhanced in several cardiac diseases, altering the signaling pathways by which CaMKII regulates the different fundamental proteins involved in functional and transcriptional cardiac processes. Dysregulation of these pathways constitutes a central mechanism of various cardiac disease phenomena, like apoptosis and necrosis during ischemia/reperfusion injury, digitalis exposure, post-acidosis and heart failure arrhythmias, or cardiac hypertrophy. Here we summarize significant aspects of the molecular physiology of CaMKII and provide a conceptual framework for understanding the role of the CaMKII cascade on Ca(2+) regulation and dysregulation in cardiac health and disease.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Oxidative stress and inflammatory processes strongly contribute to pathogenesis in Duchenne muscular dystrophy (DMD). Based on evidence that excess iron may increase oxidative stress and contribute to the inflammatory response, we investigated whether deferoxamine (DFX), a potent iron chelating agent, reduces oxidative stress and inflammation in the diaphragm (DIA) muscle of mdx mice (an experimental model of DMD). Fourteen-day-old mdx mice received daily intraperitoneal injections of DFX at a dose of 150 mg/kg body weight, diluted in saline, for 14 days. C57BL/10 and control mdx mice received daily intraperitoneal injections of saline only, for 14 days. Grip strength was evaluated as a functional measure, and blood samples were collected for biochemical assessment of muscle fiber degeneration. In addition, the DIA muscle was removed and processed for histopathology and Western blotting analysis. In mdx mice, DFX reduced muscle damage and loss of muscle strength. DFX treatment also resulted in a significant reduction of dystrophic inflammatory processes, as indicated by decreases in the inflammatory area and in NF-κB levels. DFX significantly decreased oxidative damage, as shown by lower levels of 4-hydroxynonenal and a reduction in dihydroethidium staining in the DIA muscle of mdx mice. The results of the present study suggest that DFX may be useful in therapeutic strategies to ameliorate dystrophic muscle pathology, possibly via mechanisms involving oxidative and inflammatory pathways.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Herein, we provide new contribution to the mechanisms involved in keratinocytes response to hyperosmotic shock showing, for the first time, the participation of Low Molecular Weight Protein Tyrosine Phosphatase (LMWPTP) activity in this event. We reported that sorbitol-induced osmotic stress mediates alterations in the phosphorylation of pivotal cytoskeletal proteins, particularly Src and cofilin. Furthermore, an increase in the expression of the phosphorylated form of LMWPTP, which was followed by an augment in its catalytic activity, was observed. Of particular importance, these responses occurred in an intracellular milieu characterized by elevated levels of reduced glutathione (GSH) and increased expression of the antioxidant enzymes glutathione peroxidase and glutathione reductase. Altogether, our results suggest that hyperosmostic stress provides a favorable cellular environment to the activation of LMWPTP, which is associated with increased expression of antioxidant enzymes, high levels of GSH and inhibition of Src kinase. Finally, the real contribution of LMWPTP in the hyperosmotic stress response of keratinocytes was demonstrated through analysis of the effects of ACP1 gene knockdown in stressed and non-stressed cells. LMWPTP knockdown attenuates the effects of sorbitol induced-stress in HaCaT cells, mainly in the status of Src kinase, Rac and STAT5 phosphorylation and activity. These results describe for the first time the participation of LMWPTP in the dynamics of cytoskeleton rearrangement during exposure of human keratinocytes to hyperosmotic shock, which may contribute to cell death.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Dystrophin-deficient muscles have repeated cycles of necrosis and regeneration, being susceptible to injury induced by muscle contractions. Some studies have demonstrated that tendons are also affected in mdx mice, based especially on the changes in biomechanical properties arising from the respective linked muscles. However, most studies have focused only on alterations in the myotendinous junction. Thus, the purpose of this work was to study biochemical and morphological alterations in the Achilles tendons of 60-day-old mdx mice. Hydroxyproline quantification, showed higher collagen concentration in the mdx mice as compared with the control. No difference between the tendons of both groups was found in the noncollagenous proteins dosage, and in the amount of collagen type III detected in the western blotting analysis. The zymography for gelatinases detection showed higher amounts of metaloproteinase-2 (active isoform) and of metalloproteinase-9 (latent isoform) in the mdx mice. Measurements of birefringence, using polarization microscopy, showed higher molecular organization of the collagen fibers in the tendons of mdx mice in comparison to the control group, with presence of larger areas of crimp. Ponceau SS-stained tendon sections showed stronger staining of the extracellular matrix in the mdx groups. Toluidine blue-stained sections showed more intense basophilia in tendons of the control group. In morphometry, a higher number of inflammatory cells was detected in the epitendon of mdx group. In conclusion, the Achilles tendon of 60-day-old mdx mice presents higher collagen concentration and organization of the collagen fibers, enhanced metalloproteinase-2 activity, as well as prominent presence of inflammatory cells and lesser proteoglycans.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

In this study, we aimed to evaluate the effects of exenatide (EXE) treatment on exocrine pancreas of nonhuman primates. To this end, 52 baboons (Papio hamadryas) underwent partial pancreatectomy, followed by continuous infusion of EXE or saline (SAL) for 14 weeks. Histological analysis, immunohistochemistry, Computer Assisted Stereology Toolbox morphometry, and immunofluorescence staining were performed at baseline and after treatment. The EXE treatment did not induce pancreatitis, parenchymal or periductal inflammatory cell accumulation, ductal hyperplasia, or dysplastic lesions/pancreatic intraepithelial neoplasia. At study end, Ki-67-positive (proliferating) acinar cell number did not change, compared with baseline, in either group. Ki-67-positive ductal cells increased after EXE treatment (P = 0.04). However, the change in Ki-67-positive ductal cell number did not differ significantly between the EXE and SAL groups (P = 0.13). M-30-positive (apoptotic) acinar and ductal cell number did not change after SAL or EXE treatment. No changes in ductal density and volume were observed after EXE or SAL. Interestingly, by triple-immunofluorescence staining, we detected c-kit (a marker of cell transdifferentiation) positive ductal cells co-expressing insulin in ducts only in the EXE group at study end, suggesting that EXE may promote the differentiation of ductal cells toward a β-cell phenotype. In conclusion, 14 weeks of EXE treatment did not exert any negative effect on exocrine pancreas, by inducing either pancreatic inflammation or hyperplasia/dysplasia in nonhuman primates.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Cocoa is rich in flavonoids, which are potent antioxidants with established benefits for cardiovascular health but unproven effects on neurodegeneration. Sirtuins (SIRTs), which make up a family of deacetylases, are thought to be sensitive to oxidation. In this study, the possible protective effects of cocoa in the diabetic retina were assessed. Rat Müller cells (rMCs) exposed to normal or high glucose (HG) or H2O2 were submitted to cocoa treatment in the presence or absence of SIRT-1 inhibitor and small interfering RNA The experimental animal study was conducted in streptozotocin-induced diabetic rats randomized to receive low-, intermediate-, or high-polyphenol cocoa treatments via daily gavage for 16 weeks (i.e., 0.12, 2.9 or 22.9 mg/kg/day of polyphenols). The rMCs exposed to HG or H2O2 exhibited increased glial fibrillary acidic protein (GFAP) and acetyl-RelA/p65 and decreased SIRT1 activity/expression. These effects were cancelled out by cocoa, which decreased reactive oxygen species production and PARP-1 activity, augmented the intracellular pool of NAD(+), and improved SIRT1 activity. The rat diabetic retinas displayed the early markers of retinopathy accompanied by markedly impaired electroretinogram. The presence of diabetes activated PARP-1 and lowered NAD(+) levels, resulting in SIRT1 impairment. This augmented acetyl RelA/p65 had the effect of up-regulated GFAP. Oral administration of polyphenol cocoa restored the above alterations in a dose-dependent manner. This study reveals that cocoa enriched with polyphenol improves the retinal SIRT-1 pathway, thereby protecting the retina from diabetic milieu insult.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

To evaluate p16(INK) (4a) immunoexpression in CIN1 lesions looking for differences between cases that progress to CIN2/3 maintain CIN1 diagnosis, or spontaneously regress. Seventy-four CIN1 biopsies were studied. In the follow-up, a second biopsy was performed and 28.7% showed no lesion (regression), 37.9% maintained CIN1, and 33.4% progressed to CIN2/3. Immunostaining for p16(INK) (4a) was performed in the first biopsy and it was considered positive when there was strong and diffuse staining of the basal and parabasal layers. Pearson's chi-square was used to compare the groups (p ≤ 0.05). The age of the patients was similar. There was no significant difference in p16(INK) (4a) immunoexpression in the groups, however, statistical analyses showed a significant association when only the progression and regression groups were compared (p = 0.042). Considering p16(INK) (4a) positivity and the progression to CIN2/3, the sensitivity, specificity, positive, and negative predictive values in our cohort were 45%, 75%, 47%, and 94%, respectively. We emphasize that CIN1 with p16(INK) (4a) staining was associated with lesion progression, but the sensitivity was not high. However, the negative predictive value was more reliable (94%) and p16(INK) (4a) may represent a useful biomarker that can identify CIN1 lesions that need particular attention, complementing morphology.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Pilocarpine is an alkaloid obtained from the leaves of Pilocarpus genus, with important pharmaceutical applications. Previous reports have investigated the production of pilocarpine by Pilocarpus microphyllus cell cultures and tried to establish the alkaloid biosynthetic route. However, the site of pilocarpine accumulation inside of the cell and its exchange to the medium culture is still unknown. Therefore, the aim of this study was to determine the intracellular accumulation of pilocarpine and characterise its transport across membranes in cell suspension cultures of P. microphyllus. Histochemical analysis and toxicity assays indicated that pilocarpine is most likely stored in the vacuoles probably to avoid cell toxicity. Assays with exogenous pilocarpine supplementation to the culture medium showed that the alkaloid is promptly uptaken but it is rapidly metabolised. Treatment with specific ABC protein transporter inhibitors and substances that disturb the activity of secondary active transporters suppressed pilocarpine uptake and release suggesting that both proteins may participate in the traffic of pilocarpine to inside and outside of the cells. As bafilomicin A1, a specific V-type ATPase inhibitor, had little effect and NH4Cl (induces membrane proton gradient dissipation) had moderate effect, while cyclosporin A and nifedipine (ABC proteins inhibitors) strongly inhibited the transport of pilocarpine, it is believed that ABC proteins play a major role in the alkaloid transport across membranes but it is not the exclusive one. Kinetic studies supported these results.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The aim of this study was to compare two methods of surface roughness analysis, perfilometry and spectrophotometry, applied to the surface of ionomeric materials (Chelon Fil, Vitremer and Dyract), submitted to different surface finishing treatments. For the perfilometric analysis, sixty specimens of each material were made and randomly separated into three experimental groups. The average surface roughness (Ra, mm) was measured on each specimen by a surface perfilometer (Mitutoyo Surftest 211). The spectrophotometric analysis consisted in quantifying the dye impregnated in the samples. The dyes used were 0.5% fuchsin and 0.5% erythrosin. Data were submitted to variance analysis (ANOVA) and t-Student test at a 0.05 significance level. There was no linear correlation between average roughness and superficial deposition of dye. Perfilometric analysis revealed that 12- and 30-bladed carbide burs caused the roughest surface of Chelon Fil, followed by Sof-Lex discs and mylar band. There were no significant differences between the specimens submitted to finishing and polishing with Sof-Lex discs and the control group (mylar band) for Vitremer, nevertheless, the highest Ra values were obtained when 12- and 30-bladed burs were used. For Dyract, there was no significant difference between the three treatments. The mean values of superficial deposition of dye for Chelon Fil, Vitremer and Dyract were: 1.7261, 1.4759, 1.3318, respectively. There were no significant differences between the restorative materials when different finishing and polishing systems were used.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The present work evaluated the effect of low doses of X-irradiation on the repairing process of sutured and nonsutured skin wounds in rats. For that, rats underwent a surgical proceedure, in which a 20 x 5-millimeter rectangular wound approximately 2-millimeter-deep was made in the dorsal region of each animal, and were divided in four groups: nonirradiated nonsutured; irradiated nonsutured ; nonirradiated sutured and irradiated sutured. The animals under irradiation were protected, during exposure, with a 2-millimeter-thick lead apron in such a way that only the incision was irradiated. Each animal was submitted to 18 seconds of exposure, undergoing a total of 7.4 rads. The evaluation of the effects of X-rays on the repairing process was carried out through microscopic observation by means of hematoxylin-eosin staining for morphological evaluation, and silver impregnation under polarized light for the observation of collagen synthesis. The results have shown that X-irradiation has caused delay in the repairing process, but it did not stop its development. The irradiated nonsutured group was considered to show the greater delay when compared with the other groups.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

OBJECTIVES: To evaluate the color stability and hardness of two denture liners obtained by direct and indirect techniques, after thermal cycling and immersion in beverages that can cause staining of teeth. MATERIAL AND METHODS: Seventy disc-shaped specimens (18 x 3 mm) processed by direct (DT) and indirect techniques (IT) were made from Elite soft (n=35) and Kooliner (n=35) denture liners. For each material and technique, 10 specimens were subjected to thermal cycling (3,000 cycles) and 25 specimens were stored in water, coffee, tea, soda and red wine for 36 days. The values of color change, Shore A hardness (Elite soft) and Knoop hardness (Kooliner) were obtained. The data were subjected to ANOVA, Tukey's multiple-comparison test, and Kruskal-Wallis test (P<0.05). RESULTS: The thermal cycling promoted a decrease on hardness of Kooliner regardless of the technique used (Initial: 9.09± 1.61; Thermal cycling: 7.77± 1.47) and promoted an increase in the hardness in the DT for Elite Soft (Initial: 40.63± 1.07; Thermal cycling: 43.53± 1.03); hardness of Kooliner (DT: 8.76± 0.95; IT: 7.70± 1.62) and Elite Soft (DT: 42.75± 1.54; IT=39.30± 2.31) from the DT suffered an increase after the immersion in the beverages. The thermal cycling promoted color change only for Kooliner in the IT. Immersion in the beverages did not promote color change for Elite in both techniques. The control group of the DT of Kooliner showed a significant color change. Wine and coffee produced the greatest color change in the DT only for Elite Soft when compared to the other beverages. CONCLUSION: The three variation factors promoted alteration on hardness and color of the tested denture lining materials.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This study evaluated the effect of surface sealant on the translucency of composite resin immersed in different solutions. The study involved the following materials: Charisma, Fortify and coffee, Coca-Cola®, tea and artificial saliva as solutions. Sixty-four specimens (n = 8) were manufactured and immersed in artificial saliva at 37 ± 1 °C. Samples were immersed in the solutions for three times a day and re-immersed in artificial saliva until the translucency readings. The measurements were carried out at nine times: T1 - 24 hours after specimen preparation, T2 - 24 hours after immersion in the solutions, T3 - 48 hours and T4 to T9 - 7, 14, 21, 30, 60 and 90 days, respectively, after immersion. The translucency values were measured using a JOUAN device. The results were subjected to ANOVA and Tukey's test at 5%. The surface sealant was not able to protect the composite resin against staining, the coffee showed the strongest staining action, followed by tea and regarding immersion time, a significant alteration was noted in the translucency of composite resin after 21 days.