902 resultados para detection systems
Resumo:
A capillary zone electrophoresis (CE) method was developed for the determination of the biocide 2,2-dibromo-3-nitrilo-propionamide (DBNPA) in water used in cooling systems. The biocide is indirectly determined by CE measurement of the concentration of bromide ions produced by the reaction between the DBNPA and bisulfite. The relationship between the bromide peak areas and the DBNPA concentrations showed a good linearity and a coefficient of determination (R(2)) of 0.9997 in the evaluated concentration range of 0-75 μmol L(-1). The detection and quantification limits for DBNPA were 0.23 and 0.75 μmol L(-1), respectively. The proposed CE method was successfully applied for the analysis of samples of tap water and cooling water spiked with DBNPA. The intra-day and inter-day (intermediary) precisions were lower than 2.8 and 6.2%, respectively. The DBNPA concentrations measured by the CE method were compared to the values obtained by a spectrophotometric method and were found to agree well.
Resumo:
A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
This in vitro study evaluated the tensile bond strength of glass fiber posts (Reforpost - Angelus-Brazil) cemented to root dentin with a resin cement (RelyX ARC - 3M/ESPE) associated with two different adhesive systems (Adper Single Bond - 3M/ESPE and Adper Scotchbond Multi Purpose (MP) Plus - 3M/ESPE), using the pull-out test. Twenty single-rooted human teeth with standardized root canals were randomly assigned to 2 groups (n=10): G1- etching with 37% phosphoric acid gel (3M/ESPE) + Adper Single Bond + #1 post (Reforpost - Angelus) + four #1 accessory posts (Reforpin - Angelus) + resin cement; G2- etching with 37% phosphoric acid gel + Adper Scotchbond MP Plus + #1 post + four #1 accessory posts + resin cement. The specimens were stored in distilled water at 37°C for 7 days and submitted to the pull-out test in a universal testing machine (EMIC) at a crosshead speed of 0.5 mm/min. The mean values of bond strength (kgf) and standard deviation were: G1- 29.163 ± 7.123; G2- 37.752 ±13.054. Statistical analysis (Student's t-test; a=0.05 showed no statistically significant difference (p<0.05) between the groups. Adhesive bonding failures between resin cement and root canal dentin surface were observed in both groups, with non-polymerized resin cement in the apical portion of the post space when Single Bond was used (G1). The type of adhesive system employed on the fiber post cementation did not influence the pull-out bond strength.
Resumo:
The purpose of this study was to evaluate the dentin shear bond strength of four adhesive systems (Adper Single Bond 2, Adper Prompt L-Pop, Magic Bond DE and Self Etch Bond) in regards to buccal and lingual surfaces and dentin depth. Forty extracted third molars had roots removed and crowns bisected in the mesiodistal direction. The buccal and lingual surfaces were fixed in a PVC/acrylic resin ring and were divided into buccal and lingual groups assigned to each selected adhesive. The same specimens prepared for the evaluation of superficial dentin shear resistance were used to evaluate the different depths of dentin. The specimens were identified and abraded at depths of 0.5, 1.0, 1.5 and 2.0 mm. Each depth was evaluated by ISO TR 11405 using an EMIC-2000 machine regulated at 0.5 mm/min with a 200 Kgf load cell. We performed statistical analyses on the results (ANOVA, Tukey and Scheffé tests). Data revealed statistical differences (p < 0.01) in the adhesive and depth variation as well as adhesive/depth interactions. The Adper Single Bond 2 demonstrated the highest mean values of shear bond strength. The Prompt L-Pop product, a self-etching adhesive, revealed higher mean values compared with Magic Bond DE and Self Etch Bond adhesives, a total and self-etching adhesive respectively. It may be concluded that the shear bond strength of dentin is dependent on material (adhesive system), substrate depth and adhesive/depth interaction.
Resumo:
This study evaluated the effect of chemical and mechanical surface treatments for cast metal alloys on the bond strength of an indirect composite resin (Artglass) to commercially pure titanium (cpTi). Thirty cylindrical metal rods (3 mm diameter x 60 mm long) were cast in grade-1 cpTi and randomly assigned to 6 groups (n=5) according to the received surface treatment: sandblasting; chemical treatment; mechanical treatment - 0.4 mm beads; mechanical treatment - 0.6 mm beads; chemical/mechanical treatment - 0.4 mm; and chemical/mechanical treatment - 0.6 mm beads. Artglass rings (6.0 mm diameter x 2.0 mm thick) were light cured around the cpTi rods, according manufacturer's specifications. The specimens were invested in hard gypsum and their bond strength (in MPa) to the rods was measured at fracture with a universal testing machine at a crosshead speed of 2.0 mm/min and 500 kgf load cell. Data were analyzed statistically by one-way ANOVA and Tukey test (a=5%). The surface treatments differed significantly from each other (p<0.05) regarding the recorded bond strengths. Chemical retention and sandblasting showed statistically similar results to each other (p=0.139) and both had significantly lower bond strengths (p<0.05) than the other treatments. In conclusion, mechanical retention, either associated or not to chemical treatment, provided higher bond strength of the indirect composite resin to cpTi.
Resumo:
This study evaluated in vitro the shear bond strength (SBS) of a resin-based pit-and-fissure sealant [Fluroshield (F), Dentsply/Caulk] associated with either an etch-and-rinse [Adper Single Bond 2 (SB), 3M/ESPE] or a self-etching adhesive system [Clearfil S3 Bond (S3), Kuraray Co., Ltd.] to saliva-contaminated enamel, comparing two curing protocols: individual light curing of the adhesive system and the sealant or simultaneous curing of both materials. Mesial and distal enamel surfaces from 45 sound third molars were randomly assigned to 6 groups (n=15), according to the bonding technique: I - F was applied to 37% phosphoric acid etched enamel. The other groups were contaminated with fresh human saliva (0.01 mL; 10 s) after acid etching: II - SB and F were light cured separately; III - SB and F were light cured together; IV - S3 and F were light cured separately; V - S3 and F were light cured simultaneously; VI - F was applied to saliva-contaminated, acid-etched enamel without an intermediate bonding agent layer. SBS was tested to failure in a universal testing machine at 0.5 mm/min. Data were analyzed by one-way ANOVA and Fisher's test (α=0.05).The debonded specimens were examined with a stereomicroscope to assess the failure modes. Three representative specimens from each group were observed under scanning electron microscopy for a qualitative analysis. Mean SBS in MPa were: I-12.28 (±4.29); II-8.57 (±3.19); III-7.97 (±2.16); IV-12.56 (±3.11); V-11.45 (±3.77); and VI-7.47 (±1.99). In conclusion, individual or simultaneous curing of the intermediate bonding agent layer and the resin sealant did not seem to affect bond strength to saliva-contaminated enamel. S3/F presented significantly higher SBS than the that of the groups treated with SB etch-and-rinse adhesive system and similar SBS to that of the control group, in which the sealant was applied under ideal dry, noncontaminated conditions.
Resumo:
The aim of the present study was to evaluate the influence of different photopolymerization (halogen, halogen soft-start and LED) systems on shear bond strength (SBS) and marginal microleakage of composite resin restorations. Forty Class V cavities (enamel and dentin margins) were prepared for microleakage assessment, and 160 enamel and dentin fragments were prepared for the SBS test, and divided into 4 groups. Kruskal-Wallis and Wilcoxon tests showed statistically significant difference in microleakage between the margins (p < 0.01) with incisal margins presenting the lowest values. Among the groups, it was observed that, only at the cervical margin, halogen soft-start photo polymerization presented statistically significant higher microleakage values. For SBS test, ANOVA showed no statistical difference (p > 0.05) neither between substrates nor among groups. It was concluded that Soft-Start technique with high intensity end-light influenced negatively the cervical marginal sealing, but the light-curing systems did not influence adhesion.
Resumo:
This study compared the coronal and apical leakage of AH Plus with gutta-percha to that of Epiphany with Resilon. Twenty-four single rooted teeth were instrumented and divided into 2 groups according to the solutions for smear layer removal and the obturation materials employed: Group A - 17% EDTA-T and AH Plus with gutta-percha; Group B - primer and Epiphany with Resilon. The Group B specimens were light-cured in the coronal area for 20 s. The external root surfaces were covered with a double layer of ethyl cyanoacrylate, except for the apical foramen and the cavity access. The teeth were immersed in 0.5% methylene blue for 48 h. The specimens were rinsed, dried and axially split for dye penetration measurement with the ImageLab 2.3 software. The t-test showed no significant differences for coronal leakage between the groups, but there were significant differences for apical leakage between the groups (P < 0.05). AH Plus with gutta-percha and Epiphany with Resilon provided the same coronal seal, whereas Epiphany with Resilon provided the best apical seal.
Resumo:
The purpose of this study was to evaluate the influence of intrapulpal pressure simulation on the bonding effectiveness of etch & rinse and self-etch adhesives to dentin. Eighty sound human molars were distributed into eight groups, according to the permeability level of each sample, measured by an apparatus to assess hydraulic conductance (Lp). Thus, a similar mean permeability was achieved in each group. Three etch & rinse adhesives (Prime & Bond NT - PB, Single Bond -SB, and Excite - EX) and one self-etch system (Clearfil SE Bond - SE) were employed, varying the presence or absence of an intrapulpal pressure (IPP) simulation of 15 cmH2O. After adhesive and restorative procedures were carried out, the samples were stored in distilled water for 24 hours at 37°C, and taken for tensile bond strength (TBS) testing. Fracture analysis was performed using a light microscope at 40 X magnification. The data, obtained in MPa, were then submitted to the Kruskal-Wallis test ( a = 0.05). The results revealed that the TBS of SB and EX was significantly reduced under IPP simulation, differing from the TBS of PB and SE. Moreover, SE obtained the highest bond strength values in the presence of IPP. It could be concluded that IPP simulation can influence the bond strength of certain adhesive systems to dentin and should be considered when in vitro studies are conducted.
Resumo:
Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.
Resumo:
The use of composite resins in dentistry is well accepted for restoring anterior and posterior teeth. Many polishing protocols have been evaluated for their effect on the surface roughness of restorative materials. This study compared the effect of different polishing systems on the surface roughness of microhybrid composites. Thirty-six specimens were prepared for each composite $#91;Charisma® (Heraeus Kulzer), Fill Magic® (Vigodent), TPH Spectrum® (Dentsply), Z100® (3M/ESPE) and Z250® (3M/ESPE)] and submitted to surface treatment with Enhance® and PoGo® (Dentsply) points, sequential Sof-Lex XT® aluminum oxide disks (3M/ESPE), and felt disks (TDV) combined with Excel® diamond polishing paste (TDV). Average surface roughness (Ra) was measured with a mechanical roughness tester. The data were analyzed by two-way ANOVA with repetition of the factorial design and the Tukey-Kramer test (p<0.01). The F-test result for treatments and resins was high (p<0.0001 for both), indicating that the effect of the treatment applied to the specimen surface and the effect of the type of resin on surface roughness was highly significant. Regarding the interaction between polishing system and type of resin used, a p value of 0.0002 was obtained, indicating a statistically significant difference. A Ra of 1.3663 was obtained for the Sof-Lex/TPH Spectrum interaction. In contrast, the Ra for the felt disk+paste/Z250 interactions was 0.1846. In conclusion, Sof-Lex polishing system produced a higher surface roughness on TPH Spectrum resin when compared to the other interactions.
Resumo:
Secondary caries has been reported as the main reason for restoration replacement. The aim of this in vitro study was to evaluate the performance of different methods - visual inspection, laser fluorescence (DIAGNOdent), radiography and tactile examination - for secondary caries detection in primary molars restored with amalgam. Fifty-four primary molars were photographed and 73 suspect sites adjacent to amalgam restorations were selected. Two examiners evaluated independently these sites using all methods. Agreement between examiners was assessed by the Kappa test. To validate the methods, a caries-detector dye was used after restoration removal. The best cut-off points for the sample were found by a Receiver Operator Characteristic (ROC) analysis, and the area under the ROC curve (Az), and the sensitivity, specificity and accuracy of the methods were calculated for enamel (D2) and dentine (D3) thresholds. These parameters were found for each method and then compared by the McNemar test. The tactile examination and visual inspection presented the highest inter-examiner agreement for the D2 and D3 thresholds, respectively. The visual inspection also showed better performance than the other methods for both thresholds (Az = 0.861 and Az = 0.841, respectively). In conclusion, the visual inspection presented the best performance for detecting enamel and dentin secondary caries in primary teeth restored with amalgam.
Resumo:
Onion (Allium cepa) is one of the most cultivated and consumed vegetables in Brazil and its importance is due to the large laborforce involved. One of the main pests that affect this crop is the Onion Thrips (Thrips tabaci), but the spatial distribution of this insect, although important, has not been considered in crop management recommendations, experimental planning or sampling procedures. Our purpose here is to consider statistical tools to detect and model spatial patterns of the occurrence of the onion thrips. In order to characterize the spatial distribution pattern of the Onion Thrips a survey was carried out to record the number of insects in each development phase on onion plant leaves, on different dates and sample locations, in four rural properties with neighboring farms under different infestation levels and planting methods. The Mantel randomization test proved to be a useful tool to test for spatial correlation which, when detected, was described by a mixed spatial Poisson model with a geostatistical random component and parameters allowing for a characterization of the spatial pattern, as well as the production of prediction maps of susceptibility to levels of infestation throughout the area.
Resumo:
To determine the presence of Brucella ovis in ovine from Paraíba State, in the Northeast region of Brazil, 80 animals slaughtered in the public slaughterhouse of Patos city were used. Before slaughter, blood samples were collected by jugular venopuncture from each animal, and after slaughter, testicles, epidydimus and uterus were aseptically collected. For the serological diagnosis of B. ovis and B. abortus infections, the agar gel immunodiffusion (AGID) and Rose Bengal (RBT) tests were carried out, respectively. In addition, microbiological culture and polymerase chain reaction (PCR) were performed on testicle, epidydimus and uterus samples. Six animals (7.5%) tested positive for the presence of B. ovis antibodies and all animals tested negative for the presence of B. abortus antibodies. One AGID-positive animal tested positive at uterine swab culture. PCR was able to amplify DNA of Brucella spp. from the pool of testicle, epidydimus and uterus samples from AGID-positive animals. This is the first report of isolation and detection of B. ovis DNA by PCR in ovine from the Northeast region of Brazil.