Toxicity of the therapeutic potassium permanganate to tilapia Oreochromis niloticus and to non-target organisms Ceriodaphnia dubia (microcrustacean cladocera) and Pseudokirchneriella subcapitata (green microalgae)

Potassium permanganate is a chemical compound widely used in aquaculture for the control and removal of parasites, and in the prevention of diseases caused by bacteria and fungi. However, this compound can be toxic to fish, being a strong oxidant. Moreover, there is no consistent information in the literature about its toxicity to non-target organisms. The purpose of this study was to evaluate the acute toxicity (LC50;96h) of potassium permanganate for tilapia, Oreochromis niloticus, and to determine its toxic effects on nontarget organisms using ecotoxicological assays performed with the microcrustacean Ceriodaphnia dubia and with the green microalgae Pseudokirchneriella subcapitata. The results showed that the concentration of 1.81 mg L-1 of potassium permanganate caused acute toxic effect in tilapia fingerlings. The ecotoxicological assays demonstrated that concentrations above 0.12 mg L-1 can cause chronic toxic effects on non-target organisms, indicating possible deleterious effects on the food chain of the aquatic ecosystem that may receive the discharge of effluents released by fish cultures treated with this chemotherapy. All toxic concentrations determined in this study were below those recommended in the literature for the use of this chemotherapy in fish cultures, demonstrating that this type of therapy should be more carefully considered in order to avoid damage to the treated fish and to the environment. (C) 2011 Elsevier B.V. All rights reserved.

The Influence of HOPE VI Public Housing on Public Schools

In the United States, public school enrollment is typically organized by neighborhood boundaries. This dissertation examines whether the federally funded HOPE VI program influenced performance in neighborhood public schools. In effect since 1992, HOPE VI has sought to revitalize distressed public housing using the New Urbanism model of mixed income communities. There are 165 such HOPE VI projects nationwide. Despite nearly two decades of the program’s implementation, the literature on its connection to public school performance is thin. My dissertation aims to narrow this research gap. There are three principal research questions: (1) Following HOPE VI, was there a change in socioeconomic status (SES) in the neighborhood public school? The hypothesis is that low SES (measured as the proportion of students qualifying for the Free and Reduced Lunch Program) would reduce. (2) Following HOPE VI, did the performance of neighborhood public schools change? The hypothesis is that the school performance, measured by the proportion of 5th grade students proficient in state wide math and reading tests, would increase. (3) What factors relate to the performance of public schools in HOPE VI communities? The focus is on non-school, neighborhood factors that influence the public school performance. For answering the first two questions, I used t-tests and regression models to test the hypotheses. The analysis shows that there is no statistically significant change in SES following HOPE VI. However, there are statistically significant increases in performance for reading and math proficiency. The results are interesting in indicating that HOPE VI neighborhood improvement may have some relationship with improving school performance. To answer the third question, I conducted a case study analysis of two HOPE VI neighborhood public schools, one which improved significantly (in Philadelphia) and one which declined the most (in Washington DC). The analysis revealed three insights into neighborhood factors for improved school performance: (i) a strong local community organization; (ii) local community’s commitment (including the middle income families) to send children to the public school; and (iii) ties between housing and education officials to implement the federal housing program. In essence, the study reveals how housing policy is de facto education policy.

Le principe québécois de l'impartageabilité de la réserve des coopératives non financières: discussion critique autour du maintien ou de la suppression

La réserve générale interdite de partage entre les membres est un avoir obligatoire, impartageable tout au long de l’existence de la coopérative et sujet à la «dévolution désintéressée en cas de liquidation ou de dissolution». Cette réserve fonctionne comme un levier de soutien au développement de la coopérative et du mouvement coopératif dans son ensemble. Le principe de l’impartageabilité de la réserve est l’interdiction faite à toutes les coopératives du Québec de partager la réserve générale entre tous les membres et l’interdiction de la diminuer, notamment par l’attribution d’une ristourne tout au long de l’existence de la coopérative. En effet, l’impartageabilité de la réserve se fonde sur l’idée que la coopérative n’a pas pour but l’accumulation des capitaux afin de les répartir entre les membres, mais il s’agit de la création d’un capital collectif qui bénéficie à tous les adhérents présents et futurs. Si le concept de l’impartageabilité de la réserve interdit donc le partage de la réserve tout au long de l’existence de la coopérative, cette même interdiction prend le nom de la dévolution désintéressée de l’actif net au moment de la disparition de la coopérative. Cette dévolution désintéressée signifie l’interdiction faite à toutes les coopératives non financières de partager le solde de l’actif lors de la disparition (dissolution ou liquidation) de la coopérative à l’exception des coopératives agricoles qui peuvent décider dans ce cas, de distribuer le solde de l’actif aux membres sans qu’on sache les raisons de cette exception. Par ailleurs, l’impartageabilité de la réserve est considérée comme un simple inconvénient juridique pour les membres et a connu quelques réécritures dans les législations sur les coopératives sans qu’on connaisse vraiment les raisons de ces modifications. L’objectif de notre thèse est d’engager une discussion critique autour du questionnement central suivant : au regard du cadre juridique actuel sur les coopératives, le principe de l’impartageabilité de la réserve doit être maintenu comme tel dans la Loi sur les coopératives, ou être tout simplement supprimé, comme dans la société par actions, où il est inexistant sans que cette suppression ne porte atteinte à la notion juridique de la coopérative? Plus précisément, quel est ce cadre juridique et quels sont les motifs qui peuvent plaider en faveur du maintien ou de la suppression du principe de l’impartageabilité de la réserve? Pour répondre à cette question, cette thèse se divise en deux parties. La première partie explore le cadre juridique des coopératives non financières au Québec en comparaison avec certains concepts juridiques issus d’autres législations. Elle étudie les fondements juridiques sous-jacents à l’impartageabilité de la réserve en droit québécois des coopératives non financières. La deuxième partie réalise une discussion critique autour de l’histoire du principe de l’impartageabilité de la réserve (ch. 3), des différents arguments juridiques disponibles (ch. 4) et d’hypothèses articulées autour des effets concrets disponibles (ch. 5). Elle explore ces dimensions au soutien du maintien ou non de l’impartageabilité de la réserve de la législation actuelle sur les coopératives non financières. Bien que la recherche effectuée conduise à une réponse nuancée, l'ensemble des résultats milite plutôt en faveur du maintien du principe de l'impartageabilité de la réserve. Au préalable, l’observation des fondements juridiques des concepts sous-jacents à l’impartageabilité de la réserve en droit québécois des coopératives non financières a permis de comprendre les concepts sous-jacents à ce principe avant de répondre à la question autour de son maintien ou de sa suppression de la législation actuelle sur les coopératives. La discussion réalisée a permis de souligner l’importance d’une réalité de base assez évidente : ce principe permet de préserver la réserve, utile au développement de la coopérative et du mouvement coopératif dans son ensemble. De plus, ce principe de l’impartageabilité de la réserve s’inscrit dans le cadre de la vocation sociale de la coopérative, qui n’a pas pour but la maximisation du profit pécuniaire. L’impartageabilité de la réserve s’inscrit également dans le cadre de la cohérence du droit québécois des coopératives avec la notion de coopérative telle que définie par le mouvement coopératif québécois et l’ACI tout en répondant aux finalités historiques d’équité entre les générations et de solidarité. Enfin, même si la discussion des arguments tirés des illustrations de données comptables et de quelques entretiens réalisés avec certains membres actifs du mouvement coopératif ne permet pas de mener à toute conclusion ferme, il ressort que l’impartageabilité de la réserve ne freinerait pas la tendance à la hausse des investissements et du chiffre d’affaires des coopératives non financières. Cette interdiction constituerait même un mécanisme d’autofinancement de la coopérative et un symbole de solidarité.

Le principe québécois de l'impartageabilité de la réserve des coopératives non financières: discussion critique autour du maintien ou de la suppression

La réserve générale interdite de partage entre les membres est un avoir obligatoire, impartageable tout au long de l’existence de la coopérative et sujet à la «dévolution désintéressée en cas de liquidation ou de dissolution». Cette réserve fonctionne comme un levier de soutien au développement de la coopérative et du mouvement coopératif dans son ensemble. Le principe de l’impartageabilité de la réserve est l’interdiction faite à toutes les coopératives du Québec de partager la réserve générale entre tous les membres et l’interdiction de la diminuer, notamment par l’attribution d’une ristourne tout au long de l’existence de la coopérative. En effet, l’impartageabilité de la réserve se fonde sur l’idée que la coopérative n’a pas pour but l’accumulation des capitaux afin de les répartir entre les membres, mais il s’agit de la création d’un capital collectif qui bénéficie à tous les adhérents présents et futurs. Si le concept de l’impartageabilité de la réserve interdit donc le partage de la réserve tout au long de l’existence de la coopérative, cette même interdiction prend le nom de la dévolution désintéressée de l’actif net au moment de la disparition de la coopérative. Cette dévolution désintéressée signifie l’interdiction faite à toutes les coopératives non financières de partager le solde de l’actif lors de la disparition (dissolution ou liquidation) de la coopérative à l’exception des coopératives agricoles qui peuvent décider dans ce cas, de distribuer le solde de l’actif aux membres sans qu’on sache les raisons de cette exception. Par ailleurs, l’impartageabilité de la réserve est considérée comme un simple inconvénient juridique pour les membres et a connu quelques réécritures dans les législations sur les coopératives sans qu’on connaisse vraiment les raisons de ces modifications. L’objectif de notre thèse est d’engager une discussion critique autour du questionnement central suivant : au regard du cadre juridique actuel sur les coopératives, le principe de l’impartageabilité de la réserve doit être maintenu comme tel dans la Loi sur les coopératives, ou être tout simplement supprimé, comme dans la société par actions, où il est inexistant sans que cette suppression ne porte atteinte à la notion juridique de la coopérative? Plus précisément, quel est ce cadre juridique et quels sont les motifs qui peuvent plaider en faveur du maintien ou de la suppression du principe de l’impartageabilité de la réserve? Pour répondre à cette question, cette thèse se divise en deux parties. La première partie explore le cadre juridique des coopératives non financières au Québec en comparaison avec certains concepts juridiques issus d’autres législations. Elle étudie les fondements juridiques sous-jacents à l’impartageabilité de la réserve en droit québécois des coopératives non financières. La deuxième partie réalise une discussion critique autour de l’histoire du principe de l’impartageabilité de la réserve (ch. 3), des différents arguments juridiques disponibles (ch. 4) et d’hypothèses articulées autour des effets concrets disponibles (ch. 5). Elle explore ces dimensions au soutien du maintien ou non de l’impartageabilité de la réserve de la législation actuelle sur les coopératives non financières. Bien que la recherche effectuée conduise à une réponse nuancée, l'ensemble des résultats milite plutôt en faveur du maintien du principe de l'impartageabilité de la réserve. Au préalable, l’observation des fondements juridiques des concepts sous-jacents à l’impartageabilité de la réserve en droit québécois des coopératives non financières a permis de comprendre les concepts sous-jacents à ce principe avant de répondre à la question autour de son maintien ou de sa suppression de la législation actuelle sur les coopératives. La discussion réalisée a permis de souligner l’importance d’une réalité de base assez évidente : ce principe permet de préserver la réserve, utile au développement de la coopérative et du mouvement coopératif dans son ensemble. De plus, ce principe de l’impartageabilité de la réserve s’inscrit dans le cadre de la vocation sociale de la coopérative, qui n’a pas pour but la maximisation du profit pécuniaire. L’impartageabilité de la réserve s’inscrit également dans le cadre de la cohérence du droit québécois des coopératives avec la notion de coopérative telle que définie par le mouvement coopératif québécois et l’ACI tout en répondant aux finalités historiques d’équité entre les générations et de solidarité. Enfin, même si la discussion des arguments tirés des illustrations de données comptables et de quelques entretiens réalisés avec certains membres actifs du mouvement coopératif ne permet pas de mener à toute conclusion ferme, il ressort que l’impartageabilité de la réserve ne freinerait pas la tendance à la hausse des investissements et du chiffre d’affaires des coopératives non financières. Cette interdiction constituerait même un mécanisme d’autofinancement de la coopérative et un symbole de solidarité.

Statistical Analysis and Modelling Aspects of Thermally Driven Turbulence

The present work aims to provide a deeper understanding of thermally driven turbulence and to address some modelling aspects related to the physics of the flow. For this purpose, two idealized systems are investigated by Direct Numerical Simulation: the rotating and non-rotating Rayleigh-Bénard convection. The preliminary study of the flow topologies shows how the coherent structures organise into different patterns depending on the rotation rate. From a statistical perspective, the analysis of the turbulent kinetic energy and temperature variance budgets allows to identify the flow regions where the production, the transport, and the dissipation of turbulent fluctuations occur. To provide a multi-scale description of the flows, a theoretical framework based on the Kolmogorov and Yaglom equations is applied for the first time to the Rayleigh-Bénard convection. The analysis shows how the spatial inhomogeneity modulates the dynamics at different scales and wall-distances. Inside the core of the flow, the space of scales can be divided into an inhomogeneity-dominated range at large scales, an inertial-like range at intermediate scales and a dissipative range at small scales. This classic scenario breaks close to the walls, where the inhomogeneous mechanisms and the viscous/diffusive processes are important at every scale and entail more complex dynamics. The same theoretical framework is extended to the filtered velocity and temperature fields of non-rotating Rayleigh-Bénard convection. The analysis of the filtered Kolmogorov and Yaglom equations reveals the influence of the residual scales on the filtered dynamics both in physical and scale space, highlighting the effect of the relative position between the filter length and the crossover that separates the inhomogeneity-dominated range from the quasi-homogeneous range. The assessment of the filtered and residual physics results to be instrumental for the correct use of the existing Large-Eddy Simulation models and for the development of new ones.

Evaluating non-price effects of regulatory and competition enforcement interventions

This thesis provides an ex-post evaluation of the effects of regulatory and competition policy enforcement interventions on non-price dimensions of competition. Chapter 1 examines the effects of a merger between two large Dutch supermarket chains on the variety and composition of product assortment. Chapter 2 and Chapter 3 investigate, both theoretically and empirically, the effects of access regulation in fixed telecoms markets on incentives to invest in superior infrastructure technologies. Non-price effects, together with price effects, are crucial to shed light on the extent of competition in a market and assess the effectiveness of regulatory and competition authorities' interventions. When evaluating non-price effects, however, it is harder to draw conclusions on the overall impact on consumers' welfare.

Non-standard signatures from Cosmic Microwave Background polarisation

In this Thesis we focus on non-standard signatures from CMB polarisation, which might hint at the existence of new phenomena beyond the standard models for Cosmology and Particle physics. With the Planck ESA mission, CMB temperature anisotropies have been observed at the cosmic variance limit, but polarisation remains to be further investigated. CMB polarisation data are important not only because they contribute to provide tighter constraints of cosmological parameters but also because they allow the investigation of physical processes that would be precluded if just the CMB temperature maps were considered. We take polarisation data into account to assess the statistical significance of the anomalies currently observed only in the CMB temperature map and to constrain the Cosmic Birefringence (CB) effect, which is expected in parity-violating extensions of the standard electromagnetism. In particular, we propose a new one-dimensional estimator for the lack of power anomaly capable of taking both temperature and polarisation into account jointly. With the aim of studying the anisotropic CB we develop and perform two different and complementary methods able to evaluate the power spectrum of the CB. Finally, by employing these estimators and methodologies on Planck data we provide new constraints beyond what already known in literature. The measure of CMB polarisation represents a technological challenge and to make accurate estimates, one has to keep an exquisite control of the systematic effects. In order to investigate the impact of spurious signal in forthcoming CMB polarisation experiments, we study the interplay between half-wave plates (HWP) non-idealities and the beams. Our analysis suggests that certain HWP configurations, depending on the complexity of Galactic foregrounds and the beam models, significantly impacts the B-mode reconstruction fidelity and could limit the capabilities of next-generation CMB experiments. We provide also a first study of the impact of non-ideal HWPs on CB.

Investigating interpreter-mediated interaction in the Chinese bilingual courtroom: Analysis based on a multimodal corpus

This research project is based on the Multimodal Corpus of Chinese Court Interpreting (MUCCCI [mutʃɪ]), a small-scale multimodal corpus on the basis of eight authentic court hearings with Chinese-English interpreting in Mainland China. The corpus has approximately 92,500 word tokens in total. Besides the transcription of linguistic and para-linguistic features, utilizing the facial expression classification rules suggested by Black and Yacoob (1995), MUCCCI also includes approximately 1,200 annotations of facial expressions linked to the six basic types of human emotions, namely, anger, disgust, happiness, surprise, sadness, and fear (Black & Yacoob, 1995). This thesis is an example of conducting qualitative analysis on interpreter-mediated courtroom interactions through a multimodal corpus. In particular, miscommunication events (MEs) and the reasons behind them were investigated in detail. During the analysis, although queries were conducted based on non-verbal annotations when searching for MEs, both verbal and non-verbal features were considered indispensable parts contributing to the entire context. This thesis also includes a detailed description of the compilation process of MUCCCI utilizing ELAN, from data collection to transcription, POS tagging and non-verbal annotation. The research aims at assessing the possibility and feasibility of conducting qualitative analysis through a multimodal corpus of court interpreting. The concept of integrating both verbal and non-verbal features to contribute to the entire context is emphasized. The qualitative analysis focusing on MEs can provide an inspiration for improving court interpreters’ performances. All the constraints and difficulties presented can be regarded as a reference for similar research in the future.

Advancing of risk assessment of pesticides on insect pollinators: beyond honey bees (Apis mellifera L.)

The western honey bee, Apis mellifera L., is currently the model specie for pesticide risk assessment on pollinators with the assumption that the worst-case scenarios for this species are sufficiently conservative to protect other insect pollinators. However, recent studies have showed that wild species may be more sensitive to plant protection products, due to differences in biology and life cycles. Therefore, there is the need to extend the risk assessment within a more ecological approach, in order to ensure that there are no irreversible effects on non-target organisms and in the environment. My dissertation aims to expand the risk assessment to other insect pollinators (including wild and managed pollinators), in order to cover some of the gaps of the current schemes. In this thesis, it is presented three experiments that cover the early stages of a solitary bee (chapter 1), the development of molecular tools for early detection of sub-lethal effects (chapter 2) and the development of protocols to access lethal and sub-lethal effects on other pollinator taxa (Diptera; chapter 3).

Methodologies for attitude determination from MEMS sensors in vehicles

The focus of the thesis is the application of different attitude’s determination algorithms on data evaluated with MEMS sensor using a board provided by University of Bologna. MEMS sensors are a very cheap options to obtain acceleration, and angular velocity. The use of magnetometers based on Hall effect can provide further data. The disadvantage is that they have a lot of noise and drift which can affects the results. The different algorithms that have been used are: pitch and roll from accelerometer, yaw from magnetometer, attitude from gyroscope, TRIAD, QUEST, Magdwick, Mahony, Extended Kalman filter, Kalman GPS aided INS. In this work the algorithms have been rewritten to fit perfectly with the data provided from the MEMS sensor. The data collected by the board are acceleration on the three axis, angular velocity on the three axis, magnetic fields on the three axis, and latitude, longitude, and altitude from the GPS. Several tests and comparisons have been carried out installing the electric board on different vehicles operating in the air and on ground. The conclusion that can be drawn from this study is that the Magdwich filter is the best trade-off between computational capabilities required and results obtained. If attitude angles are obtained from accelerometers, gyroscopes, and magnetometer, inconsistent data are obtained for cases where high vibrations levels are noticed. On the other hand, Kalman filter based algorithms requires a high computational burden. TRIAD and QUEST algorithms doesn’t perform as well as filters.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Deficiência de vitamina A em pré-escolares da cidade do Recife, Nordeste do Brasil

RESUMO. O objetivo deste estudo foi avaliar a prevalência de deficiência de vitamina A (DVA) em pré-escolares da cidade do Recife, Nordeste Brasileiro. A amostra foi composta por 344 crianças, de 24 a 60 meses, de ambos os sexos, em 18 creches públicas da cidade do Recife, em 2007. O estado nutricional de vitamina A foi avaliado pelos indicadores bioquímico (retinol sérico) e dietético (inquérito de consumo alimentar) e o status pondo-estatural através dos índices antropométricos peso/idade (P/I), altura/idade (A/I) e peso/altura (P/A). A prevalência de níveis de retinol sérico baixos (<0,70μmol/L) foi de 7,7 por cento (IC 95 por cento 4,88 – 11,81), caracterizando a DVA como problema de saúde pública do tipo leve, segundo critérios da Organização Mundial de Saúde. Por outro lado, 29,6 por cento (IC 95 por cento 24,22 – 35,63) das crianças apresentaram níveis aceitáveis ou marginais (0,70 a 1,04μmol/L) de retinol. Em relação ao consumo de vitamina A, os valores abaixo da EAR (Estimated Average Requirement), de 210μg/dia para crianças de 24 a 47 meses e de 275μg/dia para crianças de 48 a 96 meses de idade foi de 8,1 por cento e 21,3 por cento, respectivamente. As prevalências de déficits antropométricos (<-2 escores –Z) nos pré-escolares foram de 2,5 por cento para o indicador P/I, de 8,6 por cento quanto ao A/I e de 1,5 por cento em relação ao P/A. Os dados acima evidenciam a importância da institucionalização para o adequado estado nutricional das crianças e manutenção dos estoques adequados de vitamina A. Todavia, são necessários mais estudos enfocando pré-escolares não institucionalizados, ou seja, crianças que vivem fora do ambiente privilegiado das creches

The need for adequate ethical guidelines for qualitative health research

O artigo discute a adequação de aplicar a Resolução 196/961 do Conselho Nacional de Saúde - CNS, às pesquisas qualitativas em saúde, que se baseiam em paradigmas não positivistas. Nestas pesquisas, freqüentemente as decisões sobre a pesquisa são tomadas conjuntamente com a comunidade em estudo. Há a preocupação de favorecer a justiça e a mudança social. E, uma vez que a subjetividade pode ser considerada seu instrumento privilegiado, busca-se o balanço entre objetividade e subjetividade, e discute-se como superar a visão do pesquisador. Estudamos o âmbito de aplicação e a concepção de pesquisa presentes nas diretrizes éticas internacionais e brasileiras. Verificamos que elas adotam uma concepção positivista de pesquisa, que prevê: teste de hipótese, definição prévia de todos os procedimentos pelo pesquisador e neutralidade do pesquisador e do conhecimento produzido. Serão apresentadas algumas características das pesquisas qualitativas, as implicações éticas da maneira como a pesquisa qualitativa é concebida nos paradigmas não positivistas e um breve histórico dos documentos sobre ética em pesquisa. Concluímos que não é adequado analisar estas pesquisas com base nestes documentos e sugerimos a elaboração de diretrizes específicas

Investigation of the corrosion behaviour of AA 2024-T3 in low concentrated chloride media

Aluminium alloy (AA) 2024-T3 is an important engineering material due to its widespread use in the aerospace industry. However, it is very prone to localized corrosion attack in chloride containing media, which has been mainly associated to the presence of coarse intermetallics (IMs) in its microstructure. In this work the corrosion behaviour of AA 2024-T3 in low concentrated chloride media was investigated using microscopy and electrochemical methods. TEM/EDS observations on non-corroded samples evidenced the heterogeneous composition within the IMs. In addition, SEM observations showed that intermetallics with the same nominal composition present different reactivity, and that both types of coarse IMs normally found in the alloy microstructure are prone to corrosion. Moreover, EDS analyses showed important compositional changes in corroded IMs, evidencing a selective dissolution of their more active constituents, and the onset of an intense oxygen peak, irrespective to the IM nature, indicating the formation of corrosion products. On the other hand, the results of the electrochemical investigations, in accordance with the SEM/EDS observations, evidenced that IMs corrosion dominates the electrochemical response of the alloy during the first hours of immersion in the test electrolyte. (c) 2008 Elsevier Ltd. All rights reserved.

Resource use pattern analysis for predicting resource availability in opportunistic grids

This work presents a method for predicting resource availability in opportunistic grids by means of use pattern analysis (UPA), a technique based on non-supervised learning methods. This prediction method is based on the assumption of the existence of several classes of computational resource use patterns, which can be used to predict the resource availability. Trace-driven simulations validate this basic assumptions, which also provide the parameter settings for the accurate learning of resource use patterns. Experiments made with an implementation of the UPA method show the feasibility of its use in the scheduling of grid tasks with very little overhead. The experiments also demonstrate the method`s superiority over other predictive and non-predictive methods. An adaptative prediction method is suggested to deal with the lack of training data at initialization. Further adaptative behaviour is motivated by experiments which show that, in some special environments, reliable resource use patterns may not always be detected. Copyright (C) 2009 John Wiley & Sons, Ltd.