990 resultados para SITE CONTROL
Resumo:
An 18-year-old boy with refractory epilepsy and aggressiveness associated to a hypothalamic hamartoma was submitted to a stereotactically guided lesion by thermocoagulation. The target was based on magnetic resonance (MR) images merged with computed tomography scan images taken on the day of surgery while patient was on a stereotactic frame. In order to reveal structures not discernible in MR images, the Schaltenbrand digital brain atlas was merged onto the patient`s images. Target and trajectory of the depth electrode were chosen based on three-dimensional imaging reconstructions. A surgical plan was devised to disconnect the hypothalamic hamartoma from the hypothalamus, medial forebrain bundle, fasciculus princeps, and dorsal longitudinal fasciculus. Our target was placed at the inferior portion of the posterolateral component of the hamartoma, bordering the normal hypothalamus. The patient evolved with marked lessening of aggressiveness. Seizure frequency was reduced from several seizures per day to less than one tonic-clonic seizure during sleep per month and only two episodes suggestive of partial complex seizures during daytime. These results have remained consistent over a 24-month postoperative follow-up. Functional neuroanatomy of hypothalamic connections involved in seizure propagation and aggressive behavior was reviewed.
Resumo:
Objective: To correlate the type of dental occlusion and the type of pharyngeal lymphoid tissue obstruction in children. Design: Cross-sectional study. Setting: Ambulatory ear, nose, and throat clinic of Faculdade de Medicina da Universidade de Sao Paulo. Patients: One hundred fourteen children aged 3 to 12 years presenting with mouth breathing and snoring due to tonsil and/or adenoid enlargement. Interventions: Oroscopy and nasal fiber pharyngoscopy complemented by lateral head radiography to diagnose the type of obstruction, and clinical examination to evaluate the dental occlusion. Main Outcome Measures: Tonsil and adenoid obstruction (classified from grades 1-4) and sagittal, transverse, and vertical evaluation of dental occlusion. Results: Obstructive enlargement of both tonsils and adenoids was detected in 64.9% of the sample; isolated enlargement of the adenoids, in 21.9%; isolated enlargement of the palatine tonsils, in 7.0%; and nonobstructive tonsils and adenoids, in 6.1%. All types of pharyngeal obstruction were related to a high prevalence of posterior crossbite (36.8%). Statistically significant association was found between sagittal dental occlusion and the site of lymphoid tissue obstruction (P = .02). A higher rate of class II relationship (43.2%) was detected in the group with combined adenoid and tonsil obstructive enlargement. Isolated tonsil obstruction showed a higher rate of class III relationship (37.5%). Conclusions: Different sites of obstruction of the upper airway due to enlarged lymphoid tissue are associated with different types of dental malocclusion. Findings are relevant to orthodontic and surgical decision making in these mouth-breathing patients.
Resumo:
Prophylactic vaccines for genital human papillomavirus (HPV) infection have been shown to be feasible in animal models, and suitable vaccine material based on virus-like particles can be produced in bulk at reasonable cost. Initiation of phase III clinical trials will follow definition of trial outcome measures through further epidemiological studies, and development-of assays of host protective immunity. Vaccines could in principle eliminate HPV-related disease, as the human race is the only natural host for the relevant papillomaviruses (PVs). Therapeutic vaccines for genital HPV infection are also possible, but have not yet been demonstrated as feasible in practice because the choice of vaccine antigens is difficult, the method of their optimal delivery is uncertain, and the nature of the relevant antiviral immunity is unknown. PV species specificity will require trials to be conducted in man, which will slow definition of an ideal vaccine.
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
Resumo:
This study analyzes the relationship between extracellular purines and pain perception in humans. Cerebrospinal fluid (CSF) levels of purines and their metabolites were compared between patients displaying acute and/or chronic pain syndromes and control subjects. The CSF levels of IMP, inosine, guanosine and uric acid were significantly increased in the chronic pain group and correlated with pain severity (P<0.05). Patients displaying both chronic and acute pain presented similar changes in the CSF purines concentration (P<0.05). However, in the acute pain group, only CSF inosine and uric acid levels were significantly increased (P<0.05). These findings suggest that purines, in special inosine, guanosine and uric acid, are associated with the spinal mechanisms underlying nociception. (C) 2010 Elsevier Ireland Ltd. All rights reserved.
Resumo:
A simple framework was used to analyse the determinants of potential yield of sunflower (Helianthus annuus L.) in a subtropical environment. The aim was to investigate the stability of the determinants crop duration, canopy light interception, radiation use efficiency (RUE), and harvest index (HI) at 2 sowing times and with 3 genotypes differing in crop maturity and stature. Crop growth, phenology, light interception, yield, prevailing temperature, and radiation were recorded and measured throughout the crop cycle. Significant differences in grain yield were found between the 2 sowings, but not among genotypes within each sowing. Mean yields (0% moisture) were 6 . 02 and 2 . 17 t/ha for the first sowing, on 13 September (S1), and the second sowing, on 5 March (S2), respectively. Exceptionally high yields in S1 were due to high biomass assimilation associated with the high radiation environment, high light interception owing to a greater leaf area index, and high RUE (1 . 47-1 . 62 g/MJ) across genotypes. It is proposed that the high RUE was caused by high levels of available nitrogen maintained during crop growth by frequent applications of fertiliser and sewage effluent as irrigation. In addition to differences in the radiation environment, the assimilate partitioned to grain was reduced in S2 associated with a reduction in the duration of grain-filling. Harvest index was 0 . 40 in S1 and 0 . 25 in S2. It is hypothesised that low minimum temperatures experienced in S2 reduced assimilate production and partitioning, causing premature maturation.
Resumo:
Purpose of review To perform an update review on thyroglobulin gene mutations associated with congenital hypothyroidism, thyroid cancer, and autoimmunity. Recent findings Forty-two thyroglobulin mutations have been identified in dyshormonogenetic congenital hypothyroidism. Clinical and laboratory criteria defining defective thyroglobulin synthesis are mostly related to thyroglobulin mutations, generally caused by intracellular thyroglobulin transport defects to the colloid rather than defects in thyroid hormones synthesis. Some mutated thyroglobulin may escape the rigorous chaperone control and reach the colloid, allowing a wide phenotypic spectrum that includes euthyroidism in an adequate iodine environment. In some patients, continuous levothyroxine treatment does not reduce elevated serum thyroid-stimulating hormone (TSH) levels that may lead to goiter development. Prenatally, inactive mutant thyroglobulin will not be able to synthesize thyroid hormones and may increase pituitary thyrotroph threshold for thyroid hormone feedback. Congenital goiter is a risk factor for thyroid cancer and some thyroglobulin variants may confer susceptibility to thyroid autoimmunity. Summary Advances in the understanding of thyroglobulin genetic defects and its severity should allow researchers to perform adequate molecular diagnosis, genetic counseling, and intrauterine treatment to prevent subtle deficits in central nervous system development. This knowledge should improve the understanding of physiological functions of the thyroid and influence of nutritional iodine.
Resumo:
Abnormal heart-rate (HR) response during or after a graded exercise test has been recognized as a strong and an independent predictor of all-cause mortality in healthy and diseased subjects. The purpose of the present study was to evaluate the HR response during exercise in women with systemic lupus erythematosus (SLE). In this case-control study, 22 women with SLE (age 29.5 perpendicular to 1.1 years) were compared with 20 gender-, BMI-, and age-matched healthy subjects (age 26.5 +/- 1.4 years). A treadmill cardiorespiratory test was performed and HR response during exercise was evaluated by the chronotropic reserve (CR). HR recovery (Delta HRR) was defined as the difference between HR at peak exercise and at both first (Delta HRR1) and second (Delta HRR2) minutes after exercising. SLE patients presented lower peak VO(2) when compared with healthy subjects (27.6 perpendicular to 0.9 vs. 36.7 perpendicular to 1.1 ml/kg/min, p = 0.001, respectively). Additionally, SLE patients demonstrated lower CR (71.8 +/- 2.4 vs. 98.2 +/- 2.6%, p = 0.001), Delta HRR1 (22.1 +/- 2.5 vs. 32.4 +/- 2.2%, p = 0.004) and Delta HRR2 (39.1 +/- 2.9 vs. 50.8 +/- 2.5%, p = 0.001) than their healthy peers. In conclusion, SLE patients presented abnormal HR response to exercise, characterized by chronotropic incompetence and delayed Delta HRR. Lupus (2011) 20, 717-720.
Resumo:
Background: Progression and long-term renal outcome of lupus nephritis (LN) in male patients is a controversial subject in the literature. The aim of this study was to evaluate the influence of male gender on the renal outcome of LN. Methods: All male (M) LN patients who fulfilled American College of Rheumatology lupus criteria and who were referred for a kidney biopsy from 1999 to 2009 were enrolled in the study. Subjects with end-stage renal disease at baseline, or follow-up time below 6 months, were excluded. Cases were randomly matched to female (F) patients according to the class of LN, baseline estimated glomerular filtration rate (eGFR, Modification of Diet in Renal Disease simplified formula) and follow-up time. Treatment was decided by the clinical staff based on usual literature protocols. The primary endpoint was doubling of serum creatinine and/or end-stage renal disease. The secondary endpoint was defined as a variation of glomerular filtration rate (GFR) per year (Delta GFR/y index), calculated as the difference between final and initial eGFR adjusted by follow-up time for each patient. Results: We included 93 patients (31 M : 62 F). At baseline, M and F patients were not statistically different regarding WHO LN class (II 9.7%, IV 71%, V 19.3%), eGFR (M 62.4 +/- 36.4 ml/min/1.73 m(2) versus F 59.9 +/- 32.7 ml/min/1.73 m(2)), follow-up time (M 44.2 +/- 27.3 months versus F 39.9 +/- 27.9 months), and 24-hour proteinuria (M 5.3 +/- 4.6 g/day versus F 5.2 +/- 3.0 g/day), as well as age, albumin, C3, antinuclear antibody, anti-DNA antibody and haematuria. There was no difference in the primary outcome (M 19% versus F 13%, log-rank p = 0.62). However, male gender was significantly associated with a worse renal function progression, as measured by Delta GFR/y index (beta coefficient for male gender -12.4, 95% confidence interval -22.8 to -2.1, p = 0.02). The multivariate linear regression model showed that male gender remained statistically associated with a worse renal outcome even after adjustment for eGFR, proteinuria, albumin and C3 complement at baseline. Conclusion: In our study, male gender presented a worse evolution of LN (measured by an under GFR recovering) when compared with female patients with similar baseline features and treatment. Factors that influence the progression of LN in men and sex-specific treatment protocols should be further addressed in new studies. Lupus (2011) 20, 561-567.
Resumo:
The role of catecholamines in the control of the GnRH pulse generator is unclear as studies have relied on the use of peripheral or intracerebroventricular injections, which lack specificity in relation to the anatomical site of action. Direct brain site infusions have been used, however, these are limited by the ability to accurately target small brain regions. One such area of interest in the control of GnRH is the median eminence and arcuate nucleus within the medial basal hypothalamus. Here we describe a method of stereotaxically targeting this area in a large animal (sheep) and an infusion system to deliver drugs into unrestrained conscious animals. To test our technique we infused the dopamine agonist, quinpirole or vehicle into the medial basal hypothalamus of ovariectomised ewes. Quinpirole significantly suppressed LH pulsatility only in animals with injectors located close to the lateral median eminence. This in vivo result supports the hypothesis that dopamine inhibits GnRH secretion by presynaptic inhibition in the lateral median eminence. Also infusion of quinpirole into the medial basal hypothalamus suppressed prolactin secretion providing in vivo evidence that is consistent with the hypothesis that there are stimulatory autoreceptors on tubero-infundibular dopamine neurons. (C) 1997 Elsevier Science B.V.
Resumo:
In ascending aorta aneurysms, there is an enlargement of the whole vessel, whereas aortic dissections (ADs) are characterized by the cleavage of the wall into 2 sheets at the external half. We searched if alterations in collagen could be related to these diseases. Sections of aortas from 14 case patients with acute dissections, 10 case patients with aneurysms, and 9 control subjects were stained with picrosirius. Slides were analyzed under polarized microscopy to evaluate the structure of collagen fibers. The proportion of collagen was calculated in each half of the medial layer by color detection in a computerized image analysis system. Collagen appearance under polarized light was consistent with collagenolysis. The mean collagen proportions at the inner and outer halves, respectively, were 0.50 +/- 0.13 and 0.40 +/- 0.08 in the control group, 0.20 +/- 0.10 and 0.18 +/- 0.12 in the AD group, and 0.33 +/- 0.12 and 0.19 +/- 0.12 in the aneurysm group. The AD (P < .01) and control (P = .04) groups had less collagen at the external half, no difference was found in the aneurysm group (P = .71). In both halves, there was less collagen in the case patients than in the control subjects (all P < .01), but at the internal half, the decrease was significantly greater in the case patients with aneurysms than in those with dissections (P = .03; at the external half, P = .99). Aortic dissections and aneurysms show a decrease in collagen content that could be related to a weakness of the wall underlying the diseases, but the locations of the decrease differ: in dissections, it is situated mostly at the external portion of the media (site of cleavage), whereas in aneurysms, it is more diffuse, consistent with the global enlargement. (c) 2008 Elsevier Inc. All rights reserved.
A Randomized Trial of a Skin Sealant to Reduce the Risk of Incision Contamination in Cardiac Surgery
Resumo:
Background. Immobilizing skin microbes is a rational approach to reducing contamination of surgical sites by endogenous microorganisms. Methods. This randomized, controlled, parallel-group, multicenter, open-label clinical trial (ClinicalTrials.gov NCT00467857) enrolled 300 adults scheduled for elective coronary artery bypass graft surgery. Patients received iodine-based skin preparations followed by a cyanoacrylate-based skin sealant or skin preparations alone. Microbiological samples collected from sternal and graft incision sites immediately before any skin preparation, at the wound border after skin incision, and at the incision after fascial closure were evaluated quantitatively. Results. In evaluable patients, mean microbial counts in collected samples increased at the sternal site after fascial closure compared with after skin incision by 0.37 log(10) colony-forming units (CFU)/mL in the skin sealant group (n = 120) and by 0.57 log10 CFU/mL in the control group (n = 132) (p = 0.047, Wilcoxon rank sum test). At the graft site, mean microbial counts increased by 0.09 (n = 119) and 0.27 (n = 127) log(10) CFU/mL, respectively (p = 0.037). There was a 35.3% relative risk reduction in surgical site infection (SSI) occurring in the skin sealant group (9 of 146 patients, 6.2%) versus the control group (14 of 147 patients, 9.5%). In obese patients (body mass index [BMI] > 30.0 to <= 37.0 kg/m(2)), the relative risk reduction for SSI associated with skin sealant was 83.3%. Conclusions. Pretreatment with skin sealant protects against contamination of the surgical incision by migration of skin microbes. Further data are needed to confirm the impact of this technology on SSI rates in clinical practice. (Ann Thorac Surg 2011;92:632-7) (C) 2011 by The Society of Thoracic Surgeons ADULT CARDIAC
Resumo:
DsbA is a protein-folding catalyst from the periplasm of Escherichia coli that interacts with newly translocated polypeptide substrate and catalyzes the formation of disulfide bonds in these secreted proteins. The precise nature of the interaction between DsbA and unfolded substrate is not known. Here, we give a detailed analysis of the DsbA crystal structure, now refined to 1.7 Angstrom, and present a proposal for its interaction with peptide. The crystal structure of DsbA implies flexibility between the thioredoxin and helical domains that may be an important feature for the disulfide transfer reaction. A hinge point for domain motion is identified-the typo IV beta-turn Phe 63-Met 64-Gly 65-Gly 66, which connects the two domains. Three unique features on the active site surface of the DsbA molecule-a groove, hydrophobic pocket, and hydrophobic patch-form an extensive uncharged surface surrounding the active-sits disulfide. Residues that contribute to these surface features are shown to be generally conserved in eight DsbA homologues. Furthermore, the residues immediately surrounding the active-site disulfide are uncharged in all nine DsbA proteins. A model for DsbA-peptide interaction has been derived from the structure of a human thioredoxin:peptide complex. This shows that peptide could interact with DsbA in a manner similar to that with thioredoxin. The active-site disulfide and all three surrounding uncharged surface features of DsbA could, in principle, participate in the binding or stabilization of peptide.
Resumo:
1. Chrysophtharta bimaculata is a native chrysomelid species that can cause chronic defoliation of plantation and regrowth Eucalyptus forests in Tasmania, Australia. Knowledge of the dispersion pattern of C. bimaculata was needed in order to assess the efficiency of an integrated pest management (IPM) programme currently used for its control. 2. Using data from yellow flight traps, local populations of C. bimaculata adults were monitored over a season at spatial scales relevant to commercial forestry: within a 50-ha operational management unit (a forestry 'coupe') and between coupes. In addition, oviposition was monitored over a season at a subset of the between-coupe sites. 3. Dispersion indices (Taylor's Power Law and Iwao's Mean Crowding regression method) demonstrated that C. bimaculata adults were spatially aggregated within and between coupes, although the number of egg-batches laid at the between-coupe scale was uniform. Spatial autocorrelation analysis showed that trap-catches at the within-coupe level were similar (positively autocorrelated) to a radius distance of approximately 110 m, and then dissimilar (negatively autocorrelated) at approximately 250 m. At the between-coupe scale, no repeatable spatial autocorrelation patterns were observed. 4. For any individual site, rapid changes in beetle density were observed to be associated with loosely aggregated flights of beetles into and out of that site. Peak adult catches (> the weekly mean plus standard deviation trap-catch) for a site occurred for a period of 2.0 +/- 0.22 weeks at a time (n = 37), with normally only one or two peaks per site per season. Peak oviposition events for a site occurred on average 1.4 +/- 0.11 times per season and lasted 1.5 +/- 0.12 weeks. 5. Analysis of an extensive data set (n = 417) demonstrated that adult abundance at a site was positively correlated with egg density, but negatively correlated with tree damage (caused by conspecifics) and the presence of conspecific larvae. There was no relationship between adult abundance and a visual estimate of the amount of young foliage on trees. 6. Adults of C. bimaculata are show n to occur in relatively small, mobile aggregations. This means that pest surveys must be both regular (less than 2 weeks apart) and intensive (with sampling points no more than 150 m apart) if beetle populations are to be monitored with confidence. Further refinement of the current IPM strategy must recognize the problems posed by this temporal and spatial patchiness, particularly with regard to the use of biological insecticides, such as Bacillus thuringiensis, for which only a very short operational window exists.