The psychobiological model: a new explanation to intensity regulation and (in)tolerance in endurance exercise

The mechanisms underpinning fatigue and exhaustion, and the specific sources of exercise-endurance intensity regulation and (in)tolerance have been investigated for over a century. Although several scientific theories are currently available, over the past five years a new framework called Psychobiological model has been proposed. This model gives greater attention to perceptual and motivational factors than its antecedents, and their respective influence on the conscious process of decision-making and behavioral regulation. In this review we present experimental evidences and summarize the key points of the Psychobiological model to explain intensity regulation and (in)tolerance in endurance exercise. Still, we discuss how the Psychobiological model explains training-induced adaptations related to improvements in performance, experimental manipulations, its predictions, and propose future directions for this investigative area. The Psychobiological model may give a new perspective to the results already published in the literature, helping scientists to better guide their research problems, as well as to analyze and interpret new findings more accurately.

PCR fluorescente associada à eletroforese capilar como ferramenta de diagnóstico de bactérias no semen

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

Aptidão aeróbia e amplitude dos domínios de intensidade de exercício no ciclismo

INTRODUÇÃO: A determinação dos domínios de intensidade de exercício tem importantes implicações na prescrição do treino aeróbio e na elaboração de delineamentos experimentais. OBJETIVO: Analisar os efeitos do nível de aptidão aeróbia sobre a amplitude dos domínios de intensidade de exercício durante o ciclismo. MÉTODOS: Doze ciclistas (CIC), 11 corredores (COR) e oito indivíduos não treinados (NT) foram submetidos aos seguintes protocolos em diferentes dias: 1) teste progressivo para determinação do limiar de lactato (LL), consumo máximo de oxigênio (VO2máx) e sua respectiva intensidade (IVO2máx); 2) três testes de carga constante até a exaustão a 95, 100 e 110% IVO2máx para a determinação da potência crítica (PC); 3) testes até a exaustão para determinar a intensidade superior do domínio severo (Isup). As amplitudes dos domínios (moderado < LL; LL > pesado < PC; PC > severo < Isup) foram expressas como percentual da Isup (VO2). RESULTADOS: A amplitude do domínio moderado foi similar entre CIC (52 ± 8%) e COR (47 ± 4%) e significantemente maior no CIC em relação ao NT (41 ± 7%). O domínio pesado foi significantemente menor no CIC (17 ± 6%) em relação ao COR (27 ± 6%) e NT (27 ± 9%). Em relação ao domínio severo não foram encontradas diferenças significantes entre os CIC (31 ± 7%), COR (26 ± 5%) e NT (31 ± 7%). CONCLUSÃO: O domínio pesado de exercício é mais sensível a mudanças determinadas pelo nível de aptidão aeróbia, existindo a necessidade de que se atenda ao princípio da especificidade do movimento, quando se pretende obter um elevado grau de adaptação fisiológica.

Comparison of maximal lactate steady state with V2, V4, individual anaerobic threshold and lactate minimum speed in horses

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Treinamento físico e antioxidantes enzimáticos no tecido cerebral de ratos diabéticos experimentais

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Respostas fisiológicas, bioquímicas e autonômicas de nadadores submetidos a dois modelos de treinamentos em nado atado com carga equiparada

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Influência de protocolos de treino de equilíbrio no desempenho funcional de idosas com osteoporose

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Modelos bayesianos para análise de características reprodutivas de fêmeas Nelore

Pós-graduação em Genética e Melhoramento Animal - FCAV

Anamorfoses na Música Eletroacústica Mista

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Efeito das cargas de treinamento sobre parâmetros fisiológicos de futebolistas

The aim of this study was to investigate the effects of three weeks of training with intensity monitored on the aerobic capacity of professional soccer players. Fourteen players, members of a first division Brazilian Championship team in 2010, aged 22.78 +/- 3.06 years were evaluated pre and post three weeks of training. The anaerobic threshold intensity LAn was determined by bi-segmented method, for this four submaximal efforts of 800 meters with intensities 10, 12, 14 and 16 km/h were applied. Thirty three training sessions were quantified in zones according to heart rate related to the LAn (FCLAn): Z1 - 10% below, Z2 - 90-100% and Z3 - above the FCLAn. During training participants remained 31.17 +/- 14.86%, 42.96% and 25.87 +/- 14.90 +/- 16.67% in Z1, Z2, and Z3 respectively. There were no significant differences in the LAn (pre = 13,29 +/- 0,71 km.h(-1); post = 12,85 +/- 0,90 km.h(-1)), perceived exertion (pre = 11,53 +/- 1,45 u.a; post = 11,23 +/- 1,53 u.a) and FCLAn (pre = 166,64 +/- 10,69 bpm; post = 174,50 +/- 10,89 bpm) between conditions before and after training, indicating that three weeks of training are insufficient to generate positive changes in soccer players LAn.

Efeitos da estimulação elétrica neuromuscular nas circuitarias medulares inibitórias de sujeitos crônicos após acidente vascular cerebral

Pós-graduação em Fisioterapia - FCT

Preparação e caracterização do compósito poli (fluoreto de vinilideno) / polianilina com partículas de níquel

Pós-graduação em Ciência dos Materiais - FEIS

Efeitos do treinamento físico aeróbico sobre a expressão da miostatina e o trofismo de músculos esqueléticos e cardíaco de ratos espontaneamente hipertensos com insuficiência cardíaca

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

A colonização agroindustrial do cerrado em Mato Grosso (1970-2000)

Pós-graduação em História - FCLAS

Relação entre toxicidade urêmica, anemia e perda auditiva neurossensorial em indivíduos com doença renal crônica: um estudo prospectivo

Pós-graduação em Bases Gerais da Cirurgia - FMB