Detecção de Cryptosporidium serpentis em amostras fecais de serpentes utilizando PCR em tempo real

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Padronização da reação de trans-splicing in vitro em tripanosomas utilizando a técnica de RT-PCR

Pós-graduação em Biotecnologia - IQ

PCR fluorescente associada à eletroforese capilar como ferramenta de diagnóstico de bactérias no semen

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

Detecção do operon ica da produção de biofilme, gene mecA de resistência à oxacilina e identificação de espécies de Staphylococcus spp. diretamente dos frascos de hemoculturas pela técnica de PCR multiplex

Pós-graduação em Doenças Tropicais - FMB

Allele frequency of hereditary equine regional dermal asthenia in American Quarter horses in Brazil determined by quantitative real-time PCR with high resolution melting analysis

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Evaluation of ERIC-PCR as Genotyping Method for Corynebacterium pseudotuberculosis Isolates

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Evaluation of hsp65 Nested PCR-Restriction Analysis (PRA) for Diagnosing Tuberculosis in a High Burden Country

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Multiplex-PCR for differentiation of Mycobacterium bovis from Mycobacterium tuberculosis complex

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Comparison of PCR with stained slides of bone marrow and lymph nodes aspirates with suspect diagnosis for leishmaniasis

Visceral leishmaniasis (VL), also known as kala-azar, is a disseminated protozoan infection caused by Leishmania donovani complex. Traditionally the definite diagnosis is made by amastigote detection in the tissue. The aim this study was to evaluate the PCR technique in stained slides of bone marrow and lymph nodes aspirates with suspect diagnosis for leishmaniasis. Slides were selected totaling 62 suspect cases (33 bone marrow samples and 29 lymph node samples) and 17 positive cases (8 bone marrow and 9 lymph node). From 62 suspect cases, 39 (62.90%) were confirmed to be positive being 17 (n = 29) lymph node aspirates and 22 (n = 33) bone marrow. This finding is in agreement with the higher sensitivity of the PCR assay compared to direct microscopic observation. In conclusion, the findings of this study supports the use of PCR on archive cytological preparation stained slides for the diagnosis of canine visceral leishmaniasis, emphasizing the higher sensitivity of this technique when compared to direct microscopic examination and mostly the use of the suspect status for the cytology samples that presents the previously mentioned particularities with focus on detecting the oligosymptomatic or assymptomatic dogs in endemic areas functioning as potential reservoirs for this disease. (C) 2014 Elsevier B.V. All rights reserved.

The detection of Cryptosporidium serpentis in snake fecal samples by real-time PCR

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Diagnosis of gastric cryptosporidiosis in birds using a duplex real-time PCR assay

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Species-specific PCR for the identification of Cooperia curticei (Nematoda: Trichostrongylidae) in sheep

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Analysis of the intestinal bacterial microbiota in maize- or sorghum-fed broiler chickens using real-time PCR

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Metodologia microbiológica convencional e reação em cadeia pela polimerase (PCR) na detecção de Salmonellasp. a partir de caldos de enriquecimento – Tetrathionato e Rappaport-Vassiliadis

The progressive increase in consumption and production of poultry meat in later years comes forth with an increase of the occurrence of foodborne diseases, including salmonellosis. Salmonellosis is caused by the ingestion of contaminated products, mainly by the consumption of poultry meat which processing and preparation for consumption were not effective to eliminate pathogens. Thus, there is a need for the development of faster more sensitive methods of detection of pathogens as a way to ensure the quality of the food offered to consumers. The goal of this essay was to evaluate the effect of enrichment broths on naturally contaminated poultry meat samples. A total of 65 samples was collected, these samples were rinsed with 370 mL of buffered peptone water (BPS) 1% according with the traditional methodology. All of the samples were enriched with both Tetrathionate (TT) and Rappaport-Vassiliadis (RV) and all were analyzed by the convencional identification method and polimerasis chain reaction (PCR). Of the 65 analized samples, 34 (52%) were positive when analized by the conventional method, while 45 (69%) were positive when analized by the PCR. Amongst the 45 positive PCR samples, 44 samples were positive when enriched with TT, while just 32 samples were positive when enriched by RV. Of the 34 positive conventional samples, 29 samples were positive when enriched by TT and 31 were positive when enriched by RV