An Isoflavone From Dipteryx Alata Vogel Is Active Against The In Vitro Neuromuscular Paralysis Of Bothrops Jararacussu Snake Venom And Bothropstoxin I, And Prevents Venom-induced Myonecrosis.

Snakebite is a neglected disease and serious health problem in Brazil, with most bites being caused by snakes of the genus Bothrops. Although serum therapy is the primary treatment for systemic envenomation, it is generally ineffective in neutralizing the local effects of these venoms. In this work, we examined the ability of 7,8,3'-trihydroxy-4'-methoxyisoflavone (TM), an isoflavone from Dipteryx alata, to neutralize the neurotoxicity (in mouse phrenic nerve-diaphragm preparations) and myotoxicity (assessed by light microscopy) of Bothrops jararacussu snake venom in vitro. The toxicity of TM was assessed using the Salmonella microsome assay (Ames test). Incubation with TM alone (200 μg/mL) did not alter the muscle twitch tension whereas incubation with venom (40 μg/mL) caused irreversible paralysis. Preincubation of TM (200 μg/mL) with venom attenuated the venom-induced neuromuscular blockade by 84% ± 5% (mean ± SEM; n = 4). The neuromuscular blockade caused by bothropstoxin-I (BthTX-I), the major myotoxic PLA2 of this venom, was also attenuated by TM. Histological analysis of diaphragm muscle incubated with TM showed that most fibers were preserved (only 9.2% ± 1.7% were damaged; n = 4) compared to venom alone (50.3% ± 5.4% of fibers damaged; n = 3), and preincubation of TM with venom significantly attenuated the venom-induced damage (only 17% ± 3.4% of fibers damaged; n = 3; p < 0.05 compared to venom alone). TM showed no mutagenicity in the Ames test using Salmonella strains TA98 and TA97a with (+S9) and without (-S9) metabolic activation. These findings indicate that TM is a potentially useful compound for antagonizing the neuromuscular effects (neurotoxicity and myotoxicity) of B. jararacussu venom.

Antimicrobial And Antiproliferative Potential Of Anadenanthera Colubrina (vell.) Brenan.

The aim of the present study was to perform an in vitro analysis of the antimicrobial and antiproliferative potential of an extract from Anadenanthera colubrina (Vell.) Brenan (angico) and chemically characterize the crude extract. Antimicrobial action was evaluated based on the minimum inhibitory concentration (MIC), minimum bactericidal/fungicidal concentration, and the inhibition of formation to oral biofilm. Cell morphology was determined through scanning electron microscopy (SEM). Six strains of tumor cells were used for the determination of antiproliferative potential. The extract demonstrated strong antifungal activity against Candida albicans ATCC 18804 (MIC = 0.031 mg/mL), with similar activity found regarding the ethyl acetate fraction. The extract and active fraction also demonstrated the capacity to inhibit the formation of Candida albicans to oral biofilm after 48 hours, with median values equal to or greater than the control group, but the difference did not achieve statistical significance (P > 0.05). SEM revealed alterations in the cell morphology of the yeast. Regarding antiproliferative activity, the extract demonstrated cytostatic potential in all strains tested. The present findings suggest strong antifungal potential for Anadenanthera colubrina (Vell.) Brenan as well as a tendency toward diminishing the growth of human tumor cells.

Overlapped Sequence Types (sts) And Serogroups Of Avian Pathogenic (apec) And Human Extra-intestinal Pathogenic (expec) Escherichia Coli Isolated In Brazil.

Avian pathogenic Escherichia coli (APEC) strains belong to a category that is associated with colibacillosis, a serious illness in the poultry industry worldwide. Additionally, some APEC groups have recently been described as potential zoonotic agents. In this work, we compared APEC strains with extraintestinal pathogenic E. coli (ExPEC) strains isolated from clinical cases of humans with extra-intestinal diseases such as urinary tract infections (UTI) and bacteremia. PCR results showed that genes usually found in the ColV plasmid (tsh, iucA, iss, and hlyF) were associated with APEC strains while fyuA, irp-2, fepC sitDchrom, fimH, crl, csgA, afa, iha, sat, hlyA, hra, cnf1, kpsMTII, clpVSakai and malX were associated with human ExPEC. Both categories shared nine serogroups (O2, O6, O7, O8, O11, O19, O25, O73 and O153) and seven sequence types (ST10, ST88, ST93, ST117, ST131, ST155, ST359, ST648 and ST1011). Interestingly, ST95, which is associated with the zoonotic potential of APEC and is spread in avian E. coli of North America and Europe, was not detected among 76 APEC strains. When the strains were clustered based on the presence of virulence genes, most ExPEC strains (71.7%) were contained in one cluster while most APEC strains (63.2%) segregated to another. In general, the strains showed distinct genetic and fingerprint patterns, but avian and human strains of ST359, or ST23 clonal complex (CC), presented more than 70% of similarity by PFGE. The results demonstrate that some zoonotic-related STs (ST117, ST131, ST10CC, ST23CC) are present in Brazil. Also, the presence of moderate fingerprint similarities between ST359 E. coli of avian and human origin indicates that strains of this ST are candidates for having zoonotic potential.

One-dimensional Silicon And Germanium Nanostructures With No Carbon Analogues.

In this work we report new silicon and germanium tubular nanostructures with no corresponding stable carbon analogues. The electronic and mechanical properties of these new tubes were investigated through ab initio methods. Our results show that these structures have lower energy than their corresponding nanoribbon structures and are stable up to high temperatures (500 and 1000 K, for silicon and germanium tubes, respectively). Both tubes are semiconducting with small indirect band gaps, which can be significantly altered by both compressive and tensile strains. Large bandgap variations of almost 50% were observed for strain rates as small as 3%, suggesting their possible applications in sensor devices. They also present high Young's modulus values (0.25 and 0.15 TPa, respectively). TEM images were simulated to help in the identification of these new structures.

Genomic And Chemical Insights Into Biosurfactant Production By The Mangrove-derived Strain Bacillus Safensis Ccma-560.

Many Bacillus species can produce biosurfactant, although most of the studies on lipopeptide production by this genus have been focused on Bacillus subtilis. Surfactants are broadly used in pharmaceutical, food and petroleum industry, and biological surfactant shows some advantages over the chemical surfactants, such as less toxicity, production from renewable, cheaper feedstocks and development of novel recombinant hyperproducer strains. This study is aimed to unveil the biosurfactant metabolic pathway and chemical composition in Bacillus safensis strain CCMA-560. The whole genome of the CCMA-560 strain was previously sequenced, and with the aid of bioinformatics tools, its biosurfactant metabolic pathway was compared to other pathways of closely related species. Fourier transform infrared (FTIR) and high-resolution TOF mass spectrometry (MS) were used to characterize the biosurfactant molecule. B. safensis CCMA-560 metabolic pathway is similar to other Bacillus species; however, some differences in amino acid incorporation were observed, and chemical analyses corroborated the genetic results. The strain CCMA-560 harbours two genes flanked by srfAC and srfAD not present in other Bacillus spp., which can be involved in the production of the analogue gramicidin. FTIR and MS showed that B. safensis CCMA-560 produces a mixture of at least four lipopeptides with seven amino acids incorporated and a fatty acid chain with 14 carbons, which makes this molecule similar to the biosurfactant of Bacillus pumilus, namely, pumilacidin. This is the first report on the biosurfactant production by B. safensis, encompassing the investigation of the metabolic pathway and chemical characterization of the biosurfactant molecule.

Ethanol Modulates The Synthesis And Catabolism Of Retinoic Acid In The Rat Prostate.

All-trans retinoic acid (atRA) maintains physiological stability of the prostate, and we reported that ethanol intake increases atRA in the rat prostate; however the mechanisms underlying these changes are unknown. We evaluated the impact of a low- and high-dose ethanol intake (UChA and UChB strains) on atRA metabolism in the dorsal and lateral prostate. Aldehyde dehydrogenase (ALDH) subtype 1A3 was increased in the dorsal prostate of UChA animals while ALDH1A1 and ALDH1A2 decreased in the lateral prostate. In UChB animals, ALDH1A1, ALDH1A2, and ALDH1A3 increased in the dorsal prostate, and ALDH1A3 decreased in the lateral prostate. atRA levels increased with the low activity of CYP2E1 and decreased with high CYP26 activity in the UChB dorsal prostate. Conversely, atRA was found to decrease when the activity of total CYP was increased in the UChA lateral prostate. Ethanol modulates the synthesis and catabolism of atRA in the prostate in a concentration-dependent manner.

Modeling The Effects Of Temperature And Ph On The Resistance Of Alicyclobacillus Acidoterrestris In Conventional Heat-treated Fruit Beverages Through A Meta-analysis Approach.

In this work, all publicly-accessible published findings on Alicyclobacillus acidoterrestris heat resistance in fruit beverages as affected by temperature and pH were compiled. Then, study characteristics (protocols, fruit and variety, °Brix, pH, temperature, heating medium, culture medium, inactivation method, strains, etc.) were extracted from the primary studies, and some of them incorporated to a meta-analysis mixed-effects linear model based on the basic Bigelow equation describing the heat resistance parameters of this bacterium. The model estimated mean D* values (time needed for one log reduction at a temperature of 95 °C and a pH of 3.5) of Alicyclobacillus in beverages of different fruits, two different concentration types, with and without bacteriocins, and with and without clarification. The zT (temperature change needed to cause one log reduction in D-values) estimated by the meta-analysis model were compared to those ('observed' zT values) reported in the primary studies, and in all cases they were within the confidence intervals of the model. The model was capable of predicting the heat resistance parameters of Alicyclobacillus in fruit beverages beyond the types available in the meta-analytical data. It is expected that the compilation of the thermal resistance of Alicyclobacillus in fruit beverages, carried out in this study, will be of utility to food quality managers in the determination or validation of the lethality of their current heat treatment processes.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Antibacterial activity of root canal filling materials for primary teeth: zinc oxide and eugenol cement, Calen paste thickened with zinc oxide, Sealapex and EndoREZ

This study evaluated in vitro the antibacterial activity of 4 root canal filling materials for primary teeth - zinc oxide and eugenol cement (ZOE), Calen paste thickened with zinc oxide (Calen/ZO), Sealapex sealer and EndoREZ sealer - against 5 bacterial strains commonly found in endodontic infections (Kocuria rhizophila, Enterococcus faecalis, Streptococcus mutans, Escherichia coli and Staphylococcus aureus) using the agar diffusion test (agar-well technique). Calen paste, 1% chlorhexidine digluconate (CHX) and distilled water served as controls. Seven wells per dish were made at equidistant points and immediately filled with the test and control materials. After incubation of the plates at 37oC for 24 h, the diameter of the zones of bacterial growth inhibition produced around the wells was measured (in mm) with a digital caliper under reflected light. Data were analyzed statistically by analysis of variance and Tukey's post-hoc test (?=0.05). There were statistically significant differences (p<0.0001) among the zones of bacterial growth inhibition produced by the different materials against all target microorganisms. K. rhizophila was inhibited more effectively (p<0.05) by ZOE, while Calen/ZO had its highest antibacterial activity against E. faecalis (p<0.05). S. mutans was inhibited by Calen/ZO, Sealapex and ZOE in the same intensity (p>0.05). E. coli was inhibited more effectively (p<0.05) by ZOE, followed by Calen/ZO and Sealapex. Calen/ZO and ZOE were equally effective (p>0.05) against S. aureus, while Sealapex had the lowest antibacterial efficacy (p<0.05) against this microorganism. EndoREZ presented antibacterial activity only against K. rhizophila and S. aureus. The Calen paste and Calen/ZO produced larger zones of inhibition than 1% CHX when the marker microorganism was E faecalis. In conclusion, the in vitro antibacterial activity of the 4 root canal filling materials for primary teeth against bacterial strains commonly found in endodontic infections can be presented in a decreasing order of efficacy as follows: ZOE>Calen/ZO>Sealapex>EndoREZ.

Isolation of extraintestinal pathogenic Escherichia coli from diarrheic dogs and their antimicrobial resistance profile

From January to December 2006, 92 Escherichia coli isolates from 25 diarrheic dogs were analyzed by screening for the presence of adhesin-encoding genes (pap, sfa, afa), hemolysin and aerobactin genes. Virulence gene frequencies detected in those isolates were: 12% pap, 1% sfa, 10% hemolysin and 6.5% aerobactin. Ten isolates were characterized as extraintestinal pathogenic E. coli (ExPEC) strains; all showed a multidrug resistance phenotype that may represent a reason for concern due the risk of dissemination of antimicrobial resistant genes to the microbiota of human beings.

Maximum inhibitory dilution of mouthwashes containing chlorhexidine and polyhexamethylene biguanide against salivary staphylococcus aureus

OBJECTIVE: The aim of the present study was to determine the in vitro maximum inhibitory dilution (MID) of two chlorhexidinebased oral mouthwashes (CHX): Noplak®, Periogard®, and one polyhexamethylene biguanide-based mouthwash (PHMB): Sanifill Premium® against 28 field Staphylococcus aureus strains using the agar dilution method. MATERIALS AND METHODS: For each product, decimal dilutions ranging from 1/10 to 1/655,360 were prepared in distilled water and added to Mueller Hinton Agar culture medium. After homogenization, the culture medium was poured onto Petri dishes. Strains were inoculated using a Steers multipoint inoculator and dishes were incubated at 37ºC for 24hours. For reading, MID was considered as the maximum dilution of the mouthwash still capable of inhibiting microbial growth. RESULTS: Sanifill Premium® inhibited the growth of all strains at 1/40 dilution and of 1 strain at 1/80 dilution. Noplak® inhibited the growth of 23 strains at 1/640 dilution and of all 28 strains at 1/320 dilution. Periogard® showed inhibited growth of 7 strains at 1/640 dilution and of all 28 strains at 1/320 dilution. Data were submitted to Kruskal-Wallis statistical test, showing significant differences between the mouthwashes evaluated (p<0.05). No significant difference was found between Noplak® and Periogard® (p>0.05). Sanifill Premium® was the least effective (p<0.05). CONCLUSION: It was concluded that CHX-based mouthwashes present better antimicrobial activity against S. Aureus than the PHMB-based mouthwash.

Isolation and characterization of Flavobacterium columnare (Bernardet et al. 2002) from four tropical fish species in Brazil

Flavobacterium columnare is the causative agent of columnaris disease in freshwater fish, implicated in skin and gill disease, often causing high mortality. The aim of this study was the isolation and characterization of Flavobacterium columnare in tropical fish in Brazil. Piracanjuba (Brycon orbignyanus), pacu (Piaractus mesopotamicus), tambaqui (Colossoma macropomum) and cascudo (Hypostomus plecostomus) were examined for external lesions showing signs of colunmaris disease such as greyish white spots, especially on the head, dorsal part and caudal fin of the fish. The sampling comprised 50 samples representing four different fish species selected for study. Samples for culture were obtained by skin and kidney scrapes with a sterile cotton swabs of columnaris disease fish and streaked onto Carlson and Pacha (1968) artificial culture medium (broth and solid) which were used for isolation. The strains in the liquid medium were Gram negative, long, filamentous, exhibited flexing movements (gliding motility), contained a large number of long slender bacteria and gathered into ‘columns'. Strains on the agar produced yellow-pale colonies, rather small, flat that had rhizoid edges. A total of four Flavobacterium columnare were isolated: 01 Brycon orbignyanus strain, 01 Piaractus mesopotamicus strain, 01 Colossoma macropomum strain, and 01 Hypostomus plecostomus strain. Biochemical characterization, with its absorption of Congo red dye, production of flexirubin-type pigments, H2S production and reduction of nitrates proved that the isolate could be classified as Flavobacterium columnare.

A multi-screening approach for marine-derived fungal metabolites and the isolation of cyclodepsipeptides from Beauveria felina

Extracts obtained from 57 marine-derived fungal strains were analyzed by HPLC-PDA, TLC and ¹H NMR. The analyses showed that the growth conditions affected the chemical profile of crude extracts. Furthermore, the majority of fungal strains which produced either bioactive of chemically distinctive crude extracts have been isolated from sediments or marine algae. The chemical investigation of the antimycobacterial and cytotoxic crude extract obtained from two strains of the fungus Beauveria felina have yielded cyclodepsipeptides related to destruxins. The present approach constitutes a valuable tool for the selection of fungal strains that produce chemically interesting or biologically active secondary metabolites.

Antibody responses elicited in mice immunized with Bacillus subtilis vaccine strains expressing Stx2B subunit of enterohaemorragic Escherichia coli O157:H7

No effective vaccine or immunotherapy is presently available for patients with the hemolytic uremic syndrome (HUS) induced by Shiga-like toxin (Stx) producedbyenterohaemorragic Escherichia coli (EHEC) strains, such as those belonging to the O157:H7 serotype. In this work we evaluated the performance of Bacillus subtilis strains, a harmless spore former gram-positive bacterium species, as a vaccine vehicle for the expression of Stx2B subunit (Stx2B). A recombinant B. subtilis vaccine strain expressing Stx2B under the control of a stress inducible promoter was delivered to BALB/c mice via oral, nasal or subcutaneous routes using both vegetative cells and spores. Mice immunized with vegetative cells by the oral route developed low but specific anti-Stx2B serum IgG and fecal IgA responses while mice immunized with recombinant spores developed anti-Stx2B responses only after administration via the parenteral route. Nonetheless, serum anti-Stx2B antibodies raised in mice immunized with the recombinant B. subtilis strain did not inhibit the toxic effects of the native toxin, both under in vitro and in vivo conditions, suggesting that either the quantity or the quality of the induced immune response did not support an effective neutralization of Stx2 produced by EHEC strains.

Structural properties of lipid reconstructs and lipid composition of normotensive and hypertensive rat vascular smooth muscle cell membranes

Multiple cell membrane alterations have been reported to be the cause of various forms of hypertension. The present study focuses on the lipid portion of the membranes, characterizing the microviscosity of membranes reconstituted with lipids extracted from the aorta and mesenteric arteries of spontaneously hypertensive (SHR) and normotensive control rat strains (WKY and NWR). Membrane-incorporated phospholipid spin labels were used to monitor the bilayer structure at different depths. The packing of lipids extracted from both aorta and mesenteric arteries of normotensive and hypertensive rats was similar. Lipid extract analysis showed similar phospholipid composition for all membranes. However, cholesterol content was lower in SHR arteries than in normotensive animal arteries. These findings contrast with the fact that the SHR aorta is hyporeactive while the SHR mesenteric artery is hyperreactive to vasopressor agents when compared to the vessels of normotensive animal strains. Hence, factors other than microviscosity of bulk lipids contribute to the vascular smooth muscle reactivity and hypertension of SHR. The excess cholesterol in the arteries of normotensive animal strains apparently is not dissolved in bulk lipids and is not directly related to vascular reactivity since it is present in both the aorta and mesenteric arteries. The lower cholesterol concentrations in SHR arteries may in fact result from metabolic differences due to the hypertensive state or to genes that co-segregate with those that determine hypertension during the process of strain selection.