999 resultados para monitoramento de lavouras
Resumo:
Twenty-two Triceps brachii muscle obtained from 11 cows aged 3 and 4 years , killed in an experimental slaughter plant, were submitted to mechanical tenderization, injection with acetic acid 0,1M and lactic acid 0,2M, ageing for 9 and 14 days and electrical stimulation (250v - 60Hz - 90s), some of them were reserved as a control group, without treatment. The 14 days ageing time presented 21% of increase in subjective tenderness and 12% of reduction in shear force, these values were similar to the electrical stimulated meat. However the injection with acids and the ageing time 9 days did not present significant effect in the texture. Although the shear force values of mechanical tenderized meat was the shortest among all treatments, suspect of superestimation because of the fractures plan created by this process. Another analyses were carried out: pH reduction curve, R value; colour analysis; weight losses by cooking and by treatment; and microbiological analysis.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Laboratory tests are essential for accurate diagnosis and cost-effective management of thyroid disorders. When the clinical suspicion is strong, hormonal levels just confirms the diagnosis. However, in most patients, symptoms are subtle and unspecific, so that only biochemical tests can detect the disorder. The objective of this article is to do a critical analysis of the appropriate use of the most important thyroid function tests, including serum concentrations of thyrotropin (TSH), thyroid hormones and antithyroid antibodies. Through a survey in the MedLine database, we discuss the major pitfalls and interferences related to daily use of these tests and recommendations are presented to optimize the use of these diagnostic tools in clinical practice.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
OBJETIVO: Comparar o uso das codificações da classificação de doenças e agravos em solicitações de afastamento do trabalho por motivo odontológico. MÉTODOS: Foram analisadas 240 solicitações emitidas em um serviço público federal entre janeiro de 2008 e dezembro de 2009. O uso da Classificação Estatística Internacional de Doenças e Problemas Relacionados à Saúde - Décima Revisão (CID-10) foi comparado ao sistema de Classificação Internacional de Doenças em Odontologia e Estomatologia (CID-OE). Foi determinada a especificidade da codificação nas solicitações de afastamento, bem como da codificação atribuída por peritos oficiais em inspeções indiretas, perícias e juntas odontológicas. RESULTADOS: Do total de atestados, 22,9% não apresentaram a CID, 7,1% apresentaram a CID-9, 3,3% a CID-OE e 66,7% a CID-10. A maioria das codificações foi concordante (55,1%), com maior especificidade nas codificações atribuídas após avaliação dos cirurgiões-dentistas peritos oficiais. CONCLUSÕES: É necessário aperfeiçoar a utilização da CID-10 entre os profissionais de Odontologia e perícia odontológica no trabalho. Sugere-se a incorporação do uso da CID-OE e da Classificação Internacional de Funcionamento, Incapacidade e Saúde para a análise dos afastamentos do trabalho, fornecendo dados relevantes para o monitoramento do absenteísmo por motivo odontológico.
Resumo:
A ocorrência de aflatoxina B1 (AFB1) em rações e aflatoxina M1 (AFM1) no leite cru foi avaliada em propriedades leiteiras situadas na região nordeste do Estado de São Paulo, Brasil, de outubro de 2005 a fevereiro de 2006. A análise de aflatoxinas foi efetuada utilizando-se colunas de imunoafinidade para purificação dos extratos, sendo a quantificação realizada através de cromatografia líquida de alta eficiência. A AFB1 foi detectada em 40% das rações em níveis de 1,0 a 19,5 μg.kg-1. A concentração de AFM1 em 36,7% de amostras de leite positivas variou de 0,010 a 0,645 μg.L-1. Somente uma amostra de leite estava acima do limite de tolerância adotado no Brasil (0,5 μg.L-1) para AFM1. Concluiu-se que as concentrações de aflatoxinas na ração e no leite foram relativamente baixas, embora a alta frequência das aflatoxinas nas amostras analisadas indique a necessidade de contínuo monitoramento a fim de prevenir a contaminação de ingredientes e rações destinadas ao gado leiteiro.
Resumo:
Increased tourist activity in coastal regions demands management strategies to reduce impacts on rocky shores. The highly populated coastal areas in southeastern Brazil are an example of degradation caused by development of industry and tourism. Among different shore impacts, trampling has been intensively studied, and may represent a significant source of stress for intertidal fauna. A randomised blocks design was applied to experimentally study the effects of two different trampling intensities on richness, diversity, density and biomass of the rocky shore fauna of Obuseiro beach, Guarujá, southeastern Brazil. Blocks were distributed in two portions of the intertidal zone, dominated respectively by Chthamalus bisinuatus (Cirripedia) and Isognomon bicolor (Bivalvia). Blocks were trampled over three months, simulating the vacation period in Brazil and were monitored for the following nine months. Results indicate that Chthamalus bisinuatus is vulnerable to trampling impacts. Richness, diversity and turn-over index tended to be higher in trampled plots four months after trampling ceased. In general, results agree with previous trampling studies, suggesting that even low intensities of trampling may cause some impact on intertidal communities. Management strategies should include isolation of sensitive areas, construction of boardwalks, visitor education and monitoring programmes. In Brazil, additional data obtained from experimental studies are necessary in order to achieve a better understanding of trampling impacts on rocky shore communities.
Resumo:
The influence of the golden lion tamarin (Leontopithecus rosalia) as a seed disperser was studied by monitoring two groups of tamarins from December 1998 to December 2000 (871.9 hours of observations) in a forest fragment in south-east Brazil. The tamarins consumed fruits of 57 species from at least 17 families. They ingested the seeds of 39 species, and 23 of these were put to germinate in the laboratory and/or in the field. L. rosalia is a legitimate seed disperser because the seeds of all species tested germinated after ingestion, albeit some in low percentages. These primates do not show a consistent effect in final seed germination, because they benefit some species while damaging others. Feces were examined for seeds that had been preyed upon or digested.
Resumo:
OBJETIVO: Verificar a associação entre relato de sibilância em crianças e adolescentes e o local de residência em relação à dispersão dos poluentes atmosféricos emitidos pelo Pólo Petroquímico (PPQ) de Guamaré (RN). MÉTODOS: Estudo transversal de relato de sibilância em crianças e adolescentes de 0 a 14 anos de idade, residentes no entorno do PPQ de Guamaré, em 2006. Foi utilizado o questionário padronizado do International Study of Asthma and Allergies in Childhood, acrescido de questões relativas ao tabagismo, renda, moradia e escolaridade. Concentrações diárias de PM10, PM2,5, carbono grafítico, SO2, NO2, O3, benzeno, tolueno e xilenos foram medidas em uma estação de monitoramento fixa. As comunidades residentes na área de influência das emissões do PPQ foram classificadas, segundo a direção preferencial dos ventos, em expostas e de referência. RESULTADOS: Participaram do estudo 209 crianças e adolescentes. As concentrações médias diárias dos poluentes monitorados mantiveram-se abaixo dos limites estabelecidos nos padrões de qualidade do ar. A prevalência de sibilos nos últimos 12 meses foi de 27,3%. Associações estatisticamente significantes com sibilos nos últimos 12 meses foram verificadas mesmo após ajustamentos para comunidades expostas [razão de chances (odds ratio, ORajust) = 2,01; intervalo de confiança de 95% (IC95%) 1,01-4,01], gênero masculino (ORajust = 2,50; IC95% 1,21-5,18) e idade de 0 a 6 anos (ORajust = 5,00; IC95% 2,41-10,39). CONCLUSÃO: Mesmo em baixas concentrações de poluentes atmosféricos, a ocorrência de sintomas respiratórios em crianças e adolescentes nas comunidades no entorno de um PPQ esteve associada a residência na direção preferencial dos ventos, mostrando-se mais vulnerável o grupo de pré-escolares do gênero masculino.