Radiação gama e atmosfera modificada passiva na qualidade de goiabas 'Pedro Sato'

O objetivo deste trabalho foi avaliar o efeito da irradiação gama associada à atmosfera modificada passiva na qualidade pós-colheita de goiabas 'Pedro Sato', verificando suas características físico-químicas. Foram utilizadas goiabas provenientes da região de Vista Alegre do Alto-SP,Brasil. Após a colheita, as goiabas foram imediatamente transportadas ao Laboratório de Frutas e Hortaliças, pertencente ao Departamento de Gestão e Tecnologia Agroindustrial, da Faculdade de Ciências Agronômicas - UNESP - Câmpus de Botucatu-SP, onde foram armazenadas a 10ºC e 90-95%UR, em câmara frigorífica, por 28 dias. Os tratamentos foram: controle 1 (sem embalagem e sem irradiação); controle 2 (embalagem de poliestireno (PS) + polietileno de baixa densidade (PEBD) e sem irradiação); tratamento 1 (PS+PEBD e 0,2kGy); tratamento 2 (PS+PEBD e 0,6kGy), e tratamento 3 (PS+PEBD e 1,0kGy). As análises realizadas foram: firmeza, sólidos solúveis (SS), acidez titulável (AT) e índice de maturação. Foi utilizado o delineamento inteiramente casualizado, com esquema fatorial 5 x 5 (tratamento x tempo). Concluiu-se que as altas doses de irradiação promoveram efeito negativo nas características físico-químicas da goiaba 'Pedro Sato', e que apenas a menor dose utilizada (0,2kGy) associada à atmosfera modificada conservou frutos com maior qualidade e aceitabilidade, indicado por maiores índice de maturação e teor de sólidos solúveis obtidos.

Diversidade de Phytophthora parasitica isolados de Citrus usando seqüências de nucleotídeos da região ITS-5.8S rDNA

Realizou-se estudo para caracterização e verificação da diversidade genética de Phytophthora parasitica, agente causador da gomose dos citros. Quatorze isolados de Phytophthora parasitica, provenientes do Estado de São Paulo, foram seqüenciados a partir das regiões internas transcritas (ITS1 e ITS2) do gene 5.8S. Obtiveram-se seqüências de 812 pb a 860 pb que foram comparadas com seqüências de outras espécies de Phytophthora spp depositadas no NCBI. Foram feitos estudos filogenéticos, utilizando-se o método neighbor-joining com 1000 bootstrap e construído o dendrograma mais representativo. Obtiveram-se os resultados de 98,88% a 100% de similaridade genética entre os 14 isolados paulistas, e 99,5% a 98,8% entre estes e a seqüência de P. nicotianae (gi| 8927482) obtida do GenBank NCBI.

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Diversidade genética em populações-núcleo de Eucalyptus grandis

No melhoramento genético de espécies florestais, uma população base ou indivíduos superiores pré-selecionados tem importância fundamental para a manutenção do programa. Indivíduos de melhores procedências e de ampla base genética propiciam a obtenção de ganhos de forma contínua. O objetivo deste trabalho foi avaliar a diversidade genética em duas populações-núcleo de Eucalyptus grandis. Foram avaliados 39 indivíduos, sendo 19 pertencentes à população 1 e 20, à população 2, utilizando-se 14 primers microssatélite. Os fragmentos foram identificados e analisados a partir dos programas GeneScan e Genotyper, utilizando-se um sequenciador automático ABI Prism 3100. O número de alelos encontrados para cada primer variou de cinco a 15 para a população 1 e, de 8 a 18 para a população 2. A heterozigosidade estimada foi maior na população 2, 0,869, contra 0,843 na população 1. A média da distância genética entre os indivíduos da população 1 foi 0,6220 e na população 2 foi 0,6112. Com a caracterização molecular dos indivíduos destas populações foi construído um banco de dados que permitirá, a partir dos parâmetros de genética de populações, monitorar esses programas de melhoramento em diferentes ciclos de seleção.

Comportamento elétrico a alta temperatura de termistor cerâmico alfa-Fe2O3 com coeficiente de temperatura negativo

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

A diversidade de interpretações como fator constituinte da formação docente: leitura e observação

Neste artigo apresentamos a análise de interpretações de estudantes em trabalhos desenvolvidos em duas disciplinas de cursos de Licenciatura em Física, nas quais realizamos atividades bastante distintas, uma envolvendo a leitura e outra a observação pelos licenciandos. Buscamos compreender falas escritas pelos estudantes como parte dessas atividades, e procuramos evidenciar a diversidade de interpretações e a relevância desse trabalho para a formação inicial. O apoio teórico em que nos sustentamos foi a análise de discurso na vertente originada na França por Michel Pêcheux. A consideração da não transparência da linguagem, e as noções de condições de produção, memória discursiva e repetição, bem como alguns aportes sobre possíveis papéis da observação na construção científica, contribuíram para a compreensão de discursos escritos pelos estudantes. Mostramos a diversidade de interpretações dos licenciados: ao opinarem sobre a possibilidade ou não de se trabalhar a física moderna e contemporânea no ensino médio, depois de lerem um texto envolvendo esse tema, e ao redigirem um texto sobre a observação na pesquisa científica.

Ativação local da rota da quinurenina por moduladores inflamatórios durante a meningite bacteriana.

Activation of the kynurenine (KYN) pathway (KP) by modulators of immune system has been observed during several neurological diseases. Here we assessed the association of chemo-/cytokine levels with the concentration of KP metabolites in cerebrospinal fluid (CSF) and plasma samples from patients with bacterial meningitis (BM). All samples were collected from 42 patients diagnosed with acute bacterial meningitis (ABM), aseptic meningitis, tuberculous meningitis and patients without infection neurological disorders. CSF and plasma concentration of metabolites from the KP was assessed by high pressure liquid chromatography (HPLC) and cytokines and chemokines by Bio-plex 200 suspension array system. Concentrations of the KP metabolites KYN and kynurenic acid (KYNA) were significantly higher in CSF of patients with ABM compared to other groups. Tryptophan (TRP), anthranilic acid (AA), 3-hydroxykynurenine (3HK) and 3-hydroxyanthranilic acid (3HAA) did not show statistical significance, although some of them presented a good accumulation during ABM. The expression of TNF-alpha, IL-6, IL-1beta, IFN-gamma, IL-10, IL-1 receptor antagonist (IL-1Ra), MIP-1alpha, MIP-1beta, MCP-1 and G-CSF was about 100-fold higher in CSF from ABM patients than other infected groups. In all CSF and plasma samples, the concentration of IL-2, IL-12(p70), IL-4, IL-8 and GM-CSF was not significant. ABM still showed significant concentrations of IL-6, IL-10, IL-1Ra and MCP-1 in plasma samples. Based on the comparison of KP metabolites concentrations between plasma and CSF samples we conclude that the activation of the tryptophan pathway upon BM occurs within the brain. This increase in KP metabolites is most due to activation of the KP by molecules as IFN-gamma and TNF-alpha in response to infection.

Caracterização in situ e diversidade genética de algodoeiros mocós (Gossypium hissutum raça marie galante) da Região Nordeste do Brasil

Brazil is one of the major centers of diversity for polyploid cotton plants; these plants belong to the genus Gossypium, which has three known species: G. hirsutum, G. barbadense and G. mustelinum. The Northeast is the only region where the three species occur, the last group being endemic. Northeast s cotton plants can be important sources of variability for genetic breeding. It is believed that great part of local diversity is being lost, due to economic, political, cultural and agricultural problems. In an attempt to mitigate this loss and delineate conservation strategies it is necessary to know how the species are found where they occur. The objective was to characterize and determine how plants are maintained in situ in the states of Maranhão, Piauí, Ceará, Rio Grande do Norte and Paraíba at the beginning of the XXI century. The in situ characterization of G. hirsutum and G. barbadense was conducted through structured interviews with the cotton plants owners and through the analysis of the environment. The data were collected during expeditions undertaken between the years 2004 to 2005. Twenty-two plants were collected in the state of Paraíba, forty-four in the state of Rio Grande do Norte, one hundred and forty-six in the state of Ceará, forty in the state of Maranhão and ninety-one plants in the state of Piauí. All plants collected in the states of Paraíba and Rio Grande do Norte belonged to moco type. Moco cotton plants also predominated in the other states, representing 92%, 62% and 78% of plants collected in Ceará, Piauí and Maranhão, respectively. The other cotton plants collected belong to the species G. barbadense. The cotton plants were found in situ as dooryard plants, roads side, feral populations, cultivation or local varieties. Great part were dooryard plants (45.2%), being major in Piauí and Maranhão. Cultivation predominated in Ceará; in Rio Grande do Norte feral populations were the most frequent and, in Paraíba, local varieties. The maintenance of moco plants is related, mainly, to the phytotherapic domestic use (20.9%) and to confection of lamp wicks (29.7%). Few inhabitants in Paraíba, Rio Grande do Norte, Piauí and none in Maranhão used harvest the plants, storage the seeds or gin; however, in Ceará, 40.5% of owners affirmed that they harvested and commercialized the fiber. It was found that the maintenance of species is dependent of the fragile cultural habits of local inhabitants, therefore the maintenance in situ is not a suitable way to conservation of genetic resources. The efforts must be directed to the continuity of collections, maintenance and characterization ex situ

Aspectos epidemiológicos, cognitivo-comportamentais e neurofisiológicos do sonho lúcido

Lucid dreaming (LD) is a mental state in which the subject is aware of being dreaming while dreaming. The prevalence of LD among Europeans, North Americans and Asians is quite variable (between 26 and 92%) (Stepansky et al., 1998; Schredl & Erlacher, 2011; Yu, 2008); in Latin Americans it is yet to be investigated. Furthermore, the neural bases of LD remain controversial. Different studies have observed that LD presents power increases in the alpha frequency band (Tyson et al., 1984), in beta oscillations recorded from the parietal cortex (Holzinger et al., 2006) and in gamma rhythm recorded from the frontal cortex (Voss et al., 2009), in comparison with non-lucid dreaming. In this thesis we report epidemiological and neurophysiological investigations of LD. To investigate the epidemiology of LD (Study 1), we developed an online questionnaire about dreams that was answered by 3,427 volunteers. In this sample, 56% were women, 24% were men and 20% did not inform their gender (the median age was 25 years). A total of 76.5% of the subjects reported recalling dreams at least once a week, and about two-thirds of them reported dreaming always in the first person, i.e. when the dreamer observes the dream from within itself, not as another dream character. Dream reports typically depicted actions (93.3%), known people (92.9%), sounds/voices (78.5%), and colored images (76.3%). The oneiric content was related to plans for upcoming days (37.8%), and memories of the previous day (13.8%). Nightmares were characterized by general anxiety/fear (65.5%), feeling of being chased (48.5%), and non-painful unpleasant sensations (47.6%). With regard to LD, 77.2% of the subjects reported having experienced LD at least once in their lifetime (44.9% reported up to 10 episodes ever). LD frequency was weakly correlated with dream recall frequency (r = 0.20, p <0.001) and was higher in men (χ2=10.2, p=0.001). The control of LD was rare (29.7%) and inversely correlated with LD duration (r=-0.38, p <0.001), which is usually short: to 48.5% of the subjects, LD takes less than 1 minute. LD occurrence is mainly associated with having sleep without a fixed time to wake up (38.3%), which increases the chance of having REM sleep (REMS). LD is also associated with stress (30.1%), which increases REMS transitions into wakefulness. Overall, the data suggest that dreams and nightmares can be evolutionarily understood as a simulation of the common situations that happen in life, and that are related to our social, psychological and biological integrity. The results also indicate that LD is a relatively common experience (but not recurrent), often elusive and difficult to control, suggesting that LD is an incomplete stationary stage (or phase transition) between REMS and wake state. Moreover, despite the variability of LD prevalence among North Americans, Europeans and Asians, our data from Latin Americans strengthens the notion that LD is a general phenomenon of the human species. To further investigate the neural bases of LD (Study 2), we performed sleep recordings of 32 non-frequent lucid dreamers (sample 1) and 6 frequent lucid dreamers (sample 2). In sample 1, we applied two cognitive-behavioral techniques to induce LD: presleep LD suggestion (n=8) and light pulses applied during REMS (n=8); in a control group we made no attempt to influence dreaming (n=16). The results indicate that it is quite difficult but still possible to induce LD, since we could induce LD in a single subject, using the suggestion technique. EEG signals from this one subject exhibited alpha (7-14 Hz) bursts prior to LD. These bursts were brief (about 3s), without significant change in muscle tone, and independent of the presence of rapid eye movements. No such bursts were observed in the remaining 31 subjects. In addition, LD exhibited significantly higher occipital alpha and right temporo-parietal gamma (30-50 Hz) power, in comparison with non-lucid REMS. In sample 2, LD presented increased frontal high-gamma (50-100 Hz) power on average, in comparison with non-lucid REMS; however, this was not consistent across all subjects, being a clear phenomenon in just one subject. We also observed that four of these volunteers showed an increase in alpha rhythm power over the occipital region, immediately before or during LD. Altogether, our preliminary results suggest that LD presents neurophysiological characteristics that make it different from both waking and the typical REMS. To the extent that the right temporo-parietal and frontal regions are related to the formation of selfconsciousness and body internal image, we suggest that an increased activity in these regions during sleep may be the neurobiological mechanism underlying LD. The alpha rhythm bursts, as well as the alpha power increase over the occipital region, may represent micro-arousals, which facilitate the contact of the brain during sleep with the external environment, favoring the occurrence of LD. This also strengthens the notion that LD is an intermediary state between sleep and wakefulness

Correlato eletroencefalográfico do estado vibracional

O estado vibracional (EV) é descrito como uma sensação de vibração intensa por todo o corpo, em que o sujeito se mantém num estado de relaxamento psicofisiológico que pode ser gerado de forma espontânea ou autoinduzida. Pessoas que aplicam esta técnica relatam alterações do estado mental e emocional, tais como: relaxamento, disposição, limpidez de pensamento, equilíbrio emocional, melhoria do raciocínio, bemestar, entre outros. Estas são, entretanto observações subjetivas, sendo a mensuração deste fenômeno uma lacuna e um desafio para a ciência. O objetivo desta pesquisa é explorar sistematicamente o estado vibracional no âmbito da neurociência. Desta forma, medidas eletroencefalográficas (EEG) foram utilizadas para observar se a sensação subjetiva de EV é acompanhada por mudanças na atividade elétrica cerebral. Além disso, para avaliar se o EV provoca algum efeito positivo em funções cognitivas como atenção e memória, foi utilizado um teste de reconhecimento de palavras antes e depois da aplicação da técnica de EV. Foram também aplicados questionários de dados gerais socioeconômicos e de saúde, do perfil de estados de humor, de qualidade do sono, além de inventários psicológicos. O foco inicial do trabalho foi a análise estatística dos dados de EEG, ficando as outras análises para uma etapa posterior. Dois grupos de voluntários foram analisados, o primeiro formado por 14 sujeitos que praticam a técnica de EV há pelo menos 10 anos (Grupo Experiente - GEXP), e o segundo formado por 11 sujeitos que nunca haviam realizado a técnica (Grupo Controle - GCONT). O GCONT obteve instruções sobre a técnica de EV antes dos experimentos. Foram realizadas análises estatísticas dos registros eletroencefalográficos, para comparar os grupos, em quatro condições: Basal, Relaxamento, Não-EV (período em que o sujeito está engajado na tarefa, mas ainda não percebe o EV) e EV (período em que o sujeito percebe o EV). Uma vez que os sujeitos do GCONT relataram não ter conseguido atingir a condição de EV propriamente, a comparação entre grupos foi feita apenas nas três condições, Basal, Relaxamento e Não-EV. Para isso, foi usado o teste de Mann-Whitney U com um limiar estatístico de p<0,05. De forma geral, o GEXP apresentou maior potência na banda de frequência alfa 2 (9,5-11,0 Hz) em todas as condições. Durante o período Não-EV, o GEXP também apresentou uma maior potência na banda de frequência alfa 3 (11,5-13,0 Hz) na região temporal esquerda, e gama 1 (30,5-55,0 Hz) e gama 2 (65,0-80,0 Hz) em regiões central, parietal e temporal esquerda, mas menor potência na banda de frequência teta 1 (3,5 - 5,0 Hz), em regiões centro-parietais. Para a análise estatística intragrupo, entre as condições, utilizou-se o teste estatístico Wilcoxon pareado. Observaram-se diferenças significativas (p<0,005), principalmente em regiões centrais, em teta 1 (3,5-5,0 Hz), sendo maior no Relaxamento, quando comparado com as condições Basal e Não-EV, no GCONT, e com o Não-EV e EV, no GEXP. No GEXP, a potência de gama 1 (30,5-55,0 Hz) e gama 2 (65,0-80,0 Hz) foi difusamente maior durante o EV, se comparado às outras três condições. Para o GCONT, apenas a condição Basal apresentou maior potência de gama 1 (30,5-55,0 Hz) e gama 2 (65,0- 80,0 Hz), se comparado com o Relaxamento. O aumento de teta 1 no Relaxamento, principalmente no GCONT, pode estar associado a uma maior sonolência deste grupo durante esta condição. Já o aumento de alfa 2 durante o Não-EV e o EV, pode estar associado com processos de atenção e cognição (DOLPPERMAYR et al., 2002; FELL et al., 2010; KLIMESCH et al., 1999; RAY E COLE, 1985). Por outro lado, o aumento da potência de gama em sujeitos experientes na técnica de EV encontrado aqui e em trabalhos anteriores, em meditadores experientes (FELL et al., 2010; LEHMANN et al., 2001; LUTZ et al., 2004), poderia estar associado a alterações nos processos mentais e cognitivos destes praticantes, tais como atenção, memória operacional, aprendizagem e percepção consciente embora, análises adicionais devam ser realizadas para excluir a possibilidade de interferência de artefatos musculares nos dados de EEG. Estes resultados suscitam a hipótese de que no engajamento da tarefa do EV e durante o EV, os sujeitos do GEXP conseguem manter-se em um estado de alerta, porém com maior nível de relaxamento e concentração. Uma inspeção mais detalhada dos dados, além de outros experimentos com diferentes protocolos, um maior número de sujeitos e pesquisas longitudinais são necessários para que testar esta hipótese

Propriedades estruturais e térmicas de vidros teluretos 20Li2O-80TeO2

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Utilizando Pesos estáticos e dinâmicos em sistemas multi-classificadores com diferentes níveis de diversidade

Although some individual techniques of supervised Machine Learning (ML), also known as classifiers, or algorithms of classification, to supply solutions that, most of the time, are considered efficient, have experimental results gotten with the use of large sets of pattern and/or that they have a expressive amount of irrelevant data or incomplete characteristic, that show a decrease in the efficiency of the precision of these techniques. In other words, such techniques can t do an recognition of patterns of an efficient form in complex problems. With the intention to get better performance and efficiency of these ML techniques, were thought about the idea to using some types of LM algorithms work jointly, thus origin to the term Multi-Classifier System (MCS). The MCS s presents, as component, different of LM algorithms, called of base classifiers, and realized a combination of results gotten for these algorithms to reach the final result. So that the MCS has a better performance that the base classifiers, the results gotten for each base classifier must present an certain diversity, in other words, a difference between the results gotten for each classifier that compose the system. It can be said that it does not make signification to have MCS s whose base classifiers have identical answers to the sames patterns. Although the MCS s present better results that the individually systems, has always the search to improve the results gotten for this type of system. Aim at this improvement and a better consistency in the results, as well as a larger diversity of the classifiers of a MCS, comes being recently searched methodologies that present as characteristic the use of weights, or confidence values. These weights can describe the importance that certain classifier supplied when associating with each pattern to a determined class. These weights still are used, in associate with the exits of the classifiers, during the process of recognition (use) of the MCS s. Exist different ways of calculating these weights and can be divided in two categories: the static weights and the dynamic weights. The first category of weights is characterizes for not having the modification of its values during the classification process, different it occurs with the second category, where the values suffers modifications during the classification process. In this work an analysis will be made to verify if the use of the weights, statics as much as dynamics, they can increase the perfomance of the MCS s in comparison with the individually systems. Moreover, will be made an analysis in the diversity gotten for the MCS s, for this mode verify if it has some relation between the use of the weights in the MCS s with different levels of diversity

Dilema da diversidade-acurácia: um estudo empírico no contexto de multiclassificadores

Multi-classifier systems, also known as ensembles, have been widely used to solve several problems, because they, often, present better performance than the individual classifiers that form these systems. But, in order to do so, it s necessary that the base classifiers to be as accurate as diverse among themselves this is also known as diversity/accuracy dilemma. Given its importance, some works have investigate the ensembles behavior in context of this dilemma. However, the majority of them address homogenous ensemble, i.e., ensembles composed only of the same type of classifiers. Thus, motivated by this limitation, this thesis, using genetic algorithms, performs a detailed study on the dilemma diversity/accuracy for heterogeneous ensembles

Análise das medidas de boa e má diversidade na construção de comitês de classificadores através de metaheurísticas de otimização multiobjetivo

Committees of classifiers may be used to improve the accuracy of classification systems, in other words, different classifiers used to solve the same problem can be combined for creating a system of greater accuracy, called committees of classifiers. To that this to succeed is necessary that the classifiers make mistakes on different objects of the problem so that the errors of a classifier are ignored by the others correct classifiers when applying the method of combination of the committee. The characteristic of classifiers of err on different objects is called diversity. However, most measures of diversity could not describe this importance. Recently, were proposed two measures of the diversity (good and bad diversity) with the aim of helping to generate more accurate committees. This paper performs an experimental analysis of these measures applied directly on the building of the committees of classifiers. The method of construction adopted is modeled as a search problem by the set of characteristics of the databases of the problem and the best set of committee members in order to find the committee of classifiers to produce the most accurate classification. This problem is solved by metaheuristic optimization techniques, in their mono and multi-objective versions. Analyzes are performed to verify if use or add the measures of good diversity and bad diversity in the optimization objectives creates more accurate committees. Thus, the contribution of this study is to determine whether the measures of good diversity and bad diversity can be used in mono-objective and multi-objective optimization techniques as optimization objectives for building committees of classifiers more accurate than those built by the same process, but using only the accuracy classification as objective of optimization

Ambientes residenciais controlados por dispositivos móveis: estudo, concepção e desenvolvimento de um aplicativo considerando a diversidade

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior