A dominant-negative mutant of human poly(ADP-ribose) polymerase affects cell recovery, apoptosis, and sister chromatid exchange following DNA damage.

Poly(ADP-ribose) polymerase [PARP; NAD+ ADP-ribosyltransferase; NAD+:poly(adenosine-diphosphate-D-ribosyl)-acceptor ADP-D-ribosyltransferase, EC 2.4.2.30] is a zinc-dependent eukaryotic DNA-binding protein that specifically recognizes DNA strand breaks produced by various genotoxic agents. To study the biological function of this enzyme, we have established stable HeLa cell lines that constitutively produce the 46-kDa DNA-binding domain of human PARP (PARP-DBD), leading to the trans-dominant inhibition of resident PARP activity. As a control, a cell line was constructed, producing a point-mutated version of the DBD, which has no affinity for DNA in vitro. Expression of the PARP-DBD had only a slight effect on undamaged cells but had drastic consequences for cells treated with genotoxic agents. Exposure of cell lines expressing the wild-type (wt) or the mutated PARP-DBD, with low doses of N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) resulted in an increase in their doubling time, a G2 + M accumulation, and a marked reduction in cell survival. However, UVC irradiation had no preferential effect on the cell growth or viability of cell lines expressing the PARP-DBD. These PARP-DBD-expressing cells treated with MNNG presented the characteristic nucleosomal DNA ladder, one of the hallmarks of cell death by apoptosis. Moreover, these cells exhibited chromosomal instability as demonstrated by higher frequencies of both spontaneous and MNNG-induced sister chromatid exchanges. Surprisingly, the line producing the mutated DBD had the same behavior as those producing the wt DBD, indicating that the mechanism of action of the dominant-negative mutant involves more than its DNA-binding function. Altogether, these results strongly suggest that PARP is an element of the G2 checkpoint in mammalian cells.

Long-term in vivo expression of the human glucocerebrosidase gene in nonhuman primates after CD34+ hematopoietic cell transduction with cell-free retroviral vector preparations.

Successful gene transfer into stem cells would provide a potentially useful therapeutic modality for treatment of inherited and acquired disorders affecting hematopoietic tissues. Coculture of primate bone marrow cells with retroviral producer cells, autologous stroma, or an engineered stromal cell line expressing human stem cell factor has resulted in a low efficiency of gene transfer as reflected by the presence of 0.1-5% of genetically modified cells in the blood of reconstituted animals. Our experiments in a nonhuman primate model were designed to explore various transduction protocols that did not involve coculture in an effort to define clinically useful conditions and to enhance transduction efficiency of repopulating cells. We report the presence of genetically modified cells at levels ranging from 0.1% (granulocytes) to 14% (B lymphocytes) more than 1 year following reconstitution of myeloablated animals with CD34+ immunoselected cells transduced in suspension culture with cytokines for 4 days with a retrovirus containing the glucocerebrosidase gene. A period of prestimulation for 7 days in the presence of autologous stroma separated from the CD34+ cells by a porous membrane did not appear to enhance transduction efficiency. Infusion of transduced CD34+ cells into animals without myeloablation resulted in only transient appearance of genetically modified cells in peripheral blood. Our results document that retroviral transduction of primate repopulating cells can be achieved without coculture with stroma or producer cells and that the proportion of genetically modified cells may be highest in the B-lymphoid lineage under the given transduction conditions.

Regulation of T-cell antigen receptor (TCR) alpha-chain expression by TCR beta-chain transcripts.

The TCR is an alpha beta heterodimer, a part of the multimeric structure through which physiological T-cell activation occurs. The expression of TCR alpha chain is greatly diminished in a beta-chain-deficient mutant Jurkat cell line (J.RT3-T3.5). The relationship between the expression of the TCR alpha and beta chains has been examined by stable transfection of a series of TCR beta-chain mutant constructs into this mutant cell line. The level of alpha-chain transcript was dramatically upregulated by the expression of the beta chain and specifically by a transcript of the beta-chain variable region alone, including a transcript in which the ATG start codon was mutated. The downregulation of the endogenous alpha-chain transcripts in mutants cells lacking complete beta-chain transcripts occurred primarily at the posttranscriptional level. This evidence for a regulatory function of the TCR beta-chain gene represents an unusual regulatory pathway in which the transcript of one gene is required for the optimal expression of another gene.

Isolation and molecular characterization of a human T-cell lymphotropic virus type II (HTLV-II), subtype B, from a healthy Pygmy living in a remote area of Cameroon: an ancient origin for HTLV-II in Africa.

We report characterization of a human T-cell lymphotropic virus type II (HTLV-II) isolated from an interleukin 2-dependent CD8 T-cell line derived from peripheral blood mononuclear cells of a healthy, HTLV-II-seropositive female Bakola Pygmy, aged 59, living in a remote equatorial forest area in south Cameroon. This HTLLV-II isolate, designated PYGCAM-1, reacted in an indirect immunofluorescence assay with HTLV-II and HTLV-I polyclonal antibodies and with an HTLV-I/II gp46 monoclonal antibody but not with HTLV-I gag p19 or p24 monoclonal antibodies. The cell line produced HTLV-I/II p24 core antigen and retroviral particles. The entire env gene (1462 bp) and most of the long terminal repeat (715 bp) of the PYGCAM-1 provirus were amplified by the polymerase chain reaction using HTLV-II-specific primers. Comparison with the long terminal repeat and envelope sequences of prototype HTLV-II strains indicated that PYGCAM-1 belongs to the subtype B group, as it has only 0.5-2% nucleotide divergence from HTLV-II B strains. The finding of antibodies to HTLV-II in sera taken from the father of the woman in 1984 and from three unrelated members of the same population strongly suggests that PYGCAM-1 is a genuine HTLV-II that has been present in this isolated population for a long time. The low genetic divergence of this African isolate from American isolates raises questions about the genetic variability over time and the origin and dissemination of HTLV-II, hitherto considered to be predominantly a New World virus.

Induction of the gene encoding mucosal vascular addressin cell adhesion molecule 1 by tumor necrosis factor alpha is mediated by NF-kappa B proteins.

Mucosal vascular addressin cell adhesion molecule 1 (MAdCAM-1) is involved in trafficking of lymphocytes to mucosal endothelium. Expression of MAdCAM-1 is induced in the murine endothelial cell line bEnd.3 by tumor necrosis factor alpha (TNF-alpha), interleukin 1, and bacterial lipopolysaccharide. Here we show that TNF-alpha enhances expression of a firefly luciferase reporter directed by the MAdCAM-1 promoter, confirming transcriptional regulation of MAdCAM-1. Mutational analysis of the promoter indicates that a DNA fragment extending from nt -132 to nt +6 of the gene is sufficient for TNF-alpha inducibility. Two regulatory sites critical for TNF-alpha induction were identified in this region. DNA-binding experiments demonstrate that NF-kappa B proteins from nuclear extracts of TNF-alpha-stimulated bEnd.3 cells bind to these sites, and transfection assays with promoter mutants of the MAdCAM-1 gene indicate that occupancy of both sites is essential for promoter function. The predominant NF-kappa B binding activity detected with these nuclear extracts is a p65 homodimer. These findings establish that, as with other endothelial cell adhesion molecules, transcriptional induction of MAdCAM-1 by TNF-alpha requires activated NF-kappa B proteins.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Microenvironment and microvascular wall modulate cancer cell progression

Tumour progression is a complex process that frequently brings to cancer metastasis, the first cause of poor prognosis of cancer affected patients. Metastasis are generated by cells escaped from a primary mass and able to enter in the circulation, survive and proliferate in a new, distant site of the organism. To reach all these goal, many different phenomena had occur within both the cancer cells and the surrounding microenvironment. In the first part of this thesis, the focus was pointed on the metastatic potential of a leiomyosarcoma cell model. The studied cancer cells demonstrated a strong invasive capacity of the ECM in vitro, principally by production of matrix metalloproteinases 2 and 9, and robust pro-angiogenic activity in the chick CAM model, that facilitate its dissemination through same chick embryo internal organs. This study, with the title “MMPs and angiogenesis affect the metastatic potential of a human vulvar leiomyosarcoma cell line”, is presented in the published form. In the second part of this work, the emphasis was given to the microvascular element of the tumour microenvironment and specifically to the perivascular pericytes. These are intriguing cells due to their uncertain involvement in the biology of cancer. It is not clear how pericytes change within the tumour microenvironment and which is their contribute during the tumour dissemination. After the characterization of the chosen pericytic cell model, an in vitro study of the interaction between pericytes and different cancer cell lines where performed. Indirect and direct cell-cell interaction as well as movement of cancer cells in presence of pericytes conditioned media was analysed, in order to investigate the reciprocal influence of pericytes and tumour cells in the context of cancer progression.

Dissecting the signaling mechanisms of IL-7-mediated autophagy regulation in T-cell acute lymphoblastic leukemia

Trabalho Final do Curso de Mestrado Integrado em Medicina, Faculdade de Medicina, Universidade de Lisboa, 2014

Establishing a Robust In Vitro Embryonic Stem Cell Differentiation Assay to Monitor the Hematopoietic Potential of DELES Clones

Afin d’effectuer des études fonctionnelles sur le génome de la souris, notre laboratoire a généré une bibliothèque de clones de cellules souches embryonnaires (ESC) présentant des suppressions chromosomiques chevauchantes aléatoires – la bibliothèque DELES. Cette bibliothèque contient des délétions couvrant environ 25% du génome murin. Dans le laboratoire, nous comptons identifier de nouveaux déterminants du destin des cellules hématopoïétiques en utilisant cet outil. Un crible primaire utilisant la benzidine pour démontrer la présence d'hémoglobine dans des corps embryoïdes (EBS) a permis d’identifier plusieurs clones délétés présentant un phénotype hématopoïétique anormal. Comme cet essai ne vérifie que la présence d'hémoglobine, le but de mon projet est d'établir un essai in vitro de différenciation des ESC permettant de mesurer le potentiel hématopoïétique de clones DELES. Mon hypothèse est que l’essai de différenciation hématopoïétique publié par le Dr Keller peut être importé dans notre laboratoire et utilisé pour étudier l'engagement hématopoïétique des clones DELES. À l’aide d’essais de RT-QPCR et de FACS, j’ai pu contrôler la cinétique de différenciation hématopoïétique en suivant l’expression des gènes hématopoïétiques et des marqueurs de surface comme CD41, c-kit, RUNX1, GATA2, CD45, β-globine 1 et TER-119. Cet essai sera utilisé pour valider le potentiel hématopoïétique des clones DELES candidats identifiés dans le crible principal. Mon projet secondaire vise à utiliser la même stratégie rétro-virale a base de Cre-loxP utilisée pour générer la bibliothèque DELES pour générer une bibliothèque de cellules KBM-7 contenant des suppressions chromosomiques chevauchantes. Mon but ici est de tester si la lignée cellulaire leuémique humaine presque haploïde KBM-7 peut être exploitée en utilisant l'approche DELES pour créer cette bibliothèque. La bibliothèque de clones KBM-7 servira à définir les activités moléculaires de drogues anti-leucémiques potentielless que nous avons identifiées dans le laboratoire parce qu’elles inhibent la croissance cellulaire dans plusieurs échantillons de leucémie myéloïde aiguë dérivés de patients. Elle me permettra également d'identifier les voies de signalisation moléculaires qui, lorsque génétiquement perturbées, peuvent conférer une résistance à ces drogues.

The Human genetic mutant cell repository /

Description based on: 7th ed. (1980)

Catalog of cell lines.

Vols. for 1982-1985 consist of data from NIGMS human genetic mutant cell repository sponsored by the National Institute of General Medical Sciences, and from NIA aging cell repository sponsored by the National Institute on Aging. Repositories located at the Institute for Medical Research, Camden, N.J.; for 1986/1987- consist of data from NIGMS human genetic mutant cell repository located at Coriell Institute for Medical Research.

Method for generation of homogeneous multicellular tumor spheroids applicable to a wide variety of cell types

Multicellular tumor spheroids (MCTS) are used as organotypic models of normal and solid tumor tissue. Traditional techniques for generating MCTS, such as growth on nonadherent surfaces, in suspension, or on scaffolds, have a number of drawbacks, including the need for manual selection to achieve a homogeneous population and the use of nonphysiological matrix compounds. In this study we describe a mild method for the generation of MCTS, in which individual spheroids form in hanging drops suspended from a microtiter plate. The method has been successfully applied to a broad range of cell lines and shows nearly 100% efficiency (i.e., one spheroid per drop). Using the hepatoma cell line, HepG2, the hanging drop method generated well-rounded MCTS with a narrow size distribution (coefficient of variation [CV] 10% to 15%, compared with 40% to 60% for growth on nonadherent surfaces). Structural analysis of HepG2 and a mammary gland adenocarcinoma cell line, MCF-7, composed spheroids, revealed highly organized, three-dimensional, tissue-like structures with an extensive extracellular matrix. The hanging drop method represents an attractive alternative for MCTS production, because it is mild, can be applied to a wide variety of cell lines, and can produce spheroids of a homogeneous size without the need for sieving or manual selection. The method has applications for basic studies of physiology and metabolism, tumor biology, toxicology, cellular organization, and the development of bioartificial tissue. (C) 2003 Wiley Periodicals, Inc.

Hodgkin's lymphoma cell lines express a fusion protein encoded by intergenically spliced mRNA for the multilectin receptor DEC-205 (CD205) and a novel C-type lectin receptor DCL-1

Classic Hodgkin's lymphoma (HL) tissue contains a small population of morphologically distinct malignant cells called Hodgkin and Reed-Sternberg (HRS) cells, associated with the development of HL. Using 3'-rapid amplification of cDNA ends ( RACE) we identified an alternative mRNA for the DEC-205 multilectin receptor in the HRS cell line L428. Sequence analysis revealed that the mRNA encodes a fusion protein between DEC-205 and a novel C-type lectin DCL-1. Although the 7.5-kb DEC-205 and 4.2-kb DCL-1 mRNA were expressed independently in myeloid and B lymphoid cell lines, the DEC-205/DCL-1 fusion mRNA (9.5 kb) predominated in the HRS cell lines ( L428, KM-H2, and HDLM-2). The DEC-205 and DCL-1 genes comprising 35 and 6 exons, respectively, are juxtaposed on chromosome band 2q24 and separated by only 5.4 kb. We determined the DCL-1 transcription initiation site within the intervening sequence by 5'-RACE, confirming that DCL-1 is an independent gene. Two DEC-205/DCL-1 fusion mRNA variants may result from cotranscription of DEC-205 and DCL-1, followed by splicing DEC-205 exon 35 or 34-35 along with DCL-1 exon 1. The resulting reading frames encode the DEC-205 ectodomain plus the DCL-1 ectodomain, the transmembrane, and the cytoplasmic domain. Using DCL-1 cytoplasmic domain-specific polyclonal and DEC-205 monoclonal antibodies for immunoprecipitation/Western blot analysis, we showed that the fusion mRNA is translated into a DEC-205/DCL-1 fusion protein, expressed in the HRS cell lines. These results imply an unusual transcriptional control mechanism in HRS cells, which cotranscribe an mRNA containing DEC-205 and DCL-1 prior to generating the intergenically spliced mRNA to produce a DEC-205/DCL-1 fusion protein.

Brca1 inactivation induces p27Kip1-dependent cell cycle arrest and delayed development in the mouse mammary gland

One common characteristic of breast cancers arising in carriers of the predisposition gene BRCA1 is a loss of expression of the CDK inhibitor p27(Kip1) (p27), suggesting that p27 interacts epistatically with BRCA1. To investigate this relationship, we examined expression of p27 in mice expressing a dominant negative allele of Brca1 (MMTV-trBr) in the mammary gland. While these mice rarely develop tumors, they showed a 50% increase in p27 protein and a delay in mammary gland development associated with reduced proliferation. In contrast, on a p27 heterozygote background, MMTV-trBrca1 mice showed an increase in S phase cells, and normal mammary development. p27 was the only protein in the cyclin cyclin-dependent kinase network to show altered expression, suggesting that it may be a central mediator of cell cycle arrest in response to loss of function of BRCA1. Furthermore, in human mammary epithelial MCF7 cells expressing BRCA1-specific RNAi and in the BRCA1-deficient human tumor cell line HCC1937, p27 is elevated at the mRNA level compared to cells expressing wild-type BRCA1. We hypothesize that disruption of BRCA1 induces an increase in p27 that inhibits proliferation. Accordingly, reduction in p27 expression leads to enhancement of cellular proliferation in the absence of BRCA1.

Fast accumulation of few polyhedra mutants during passage of a Spodoptera frugiperda multicapsid nucleopolyhedrovirus (Baculoviridae) in Sf9 cell cultures

Baculoviruses are a group of viruses that infect invertebrates and that have been used worldwide as a biopesticide against several insect pests of the Order Lepidoptera. In Brazil, the baculovirus Spodoptera frugiperda multicapsid nucleopolyhedrovirus (SfMNPV, Baculoviridae) has been used experimentally to control S. frugiperda (Lepidoptera: Noctuidae), an important insect pest of corn (maize) fields and other crops. Baculoviruses can be produced either in insect larvae or in cell culture bioreactors. A major limitation to the in vitro production of baculoviruses is the rapid generation of mutants when the virus undergoes passages in cell culture. In order to evaluate the potential of in vitro methods of producing SfMNPV on a large-scale, we have multiplied a Brazilian isolate of this virus in cell culture. Extensive formation of few polyhedra mutants was observed after only two passages in Sf9 cells.