Building a creative city brand through an international mega-event : Case: Helsinki World Design Capital 2012

In order to grow, cities are increasingly competing for attention, jobs, investments, visitors, residents and significant events. Cities need to come up with creative solutions to keep up with the competition; they ought to become creative cities. Attracting talented and diverse inhabitants is a key factor in developing a creative city, which on is characterized by openness, tolerance, vibrancy and diversity. Along the need for renewed city images city brand building has become popular. Helsinki is the World Design Capital 2012 (WDC 2012) and this mega-event presents a meaningful opportunity for the city to broadcast itself globally. The purpose of this study is to evaluate how Helsinki brands itself as a creative city through an international mega-event. The sub-aims are to: 1) Map the factors behind the creative city and their relation to the city of Helsinki, 2) Describe the city branding process, 3) Evaluate the role of the Helsinki World Design Capital 2012 mega-event in Helsinki’s creative city brand building. First, the theory discusses the concept of the creative city that has gained growing attention during the past decade. Then, the city branding process is described and the benefits of hosting a mega-event are presented. Finally, co-branding a city and a mega-event in order to generate maximum benefit from the mega-event, is reviewed. This is a qualitative research for which data was collected through three face-to-face interviews, the World Design Capital 2012 bid, Helsinki’s economic development strategy, a consulting firm’s research report on the case city and web-pages. The research reveals that Helsinki has shown interest in the creative city discussion. The terminology around the concept is however approached carefully. Helsinki fits many of the creative city characteristics and recognizes its flaws for which improvement strategies have been planned. Bottlenecks keeping the city from promoting a more open mind were mainly revealed in its organizational structures. Helsinki has no official brand strategy; nonetheless pressure to develop one is present. The World Design Capital 2012 mega-event is seen as a meaningful stepping board to strengthen Helsinki’s identity and image, and start thinking about a city brand. The brand strategies of the mega-event support the values and virtues of the city itself, which enables benefits of co-branding introduces in the theory part. Helsinki has no official brand and doesn’t call itself a creative city, however this study shows signs of the city taking steps towards building a creative city brand with the help of the Helsinki World Design Capital 2012 mega-event.

Late pleistocene ice export events into the Arctic Ocean from the M'Clure Strait Ice Stream, Canadian Arctic Archipelago

Rapidly-flowing sectors of an ice sheet (ice streams) can play ail important role in abrupt climate change through tile delivery of icebergs and meltwater and tile Subsequent disruption of ocean thermohaline circulation (e.g., the North Atlantic's Heinrich events). Recently, several cores have been raised from the Arctic Ocean which document the existence of massive ice export events during tile Late Pleistocene and whose provenance has been linked to Source regions in the Canadian Arctic Archipelago. In this paper, satellite imagery is used to map glacial geomorphology in the vicinity of Victoria Island, Banks Island and Prince of Wales Island (Canadian Arctic) in order to reconstruct ice flow patterns in the highly complex glacial landscape. A total of 88 discrete flow-sets are mapped and of these, 13 exhibit the characteristic geomorphology of palaeo-ice streams (i.e., parallel patterns of large, highly elongated mega-scale glacial lineations forming a convergent flow pattern with abrupt lateral margins). Previous studies by other workers and cross-cutting relationships indicate that the majority of these ice streams are relatively young and operated during or immediately prior to deglaciation. Our new mapping, however, documents a large (> 700 km long; 110 km wide) and relatively old ice stream imprint centred in M'Clintock Channel and converging into Viscount Melville Sound. A trough mouth fan located on the continental shelf Suggests that it extended along M'Clure Strait and was grounded at tile shelf edge. The location of the M'Clure Strait Ice Stream exactly matches the Source area of 4 (possibly 5) major ice export events recorded in core PS 1230 raised from Fram Strait, the major ice exit for the Arctic Ocean. These ice export events occur at similar to 12.9, similar to 15.6, similar to 22 and 29.8 ka (C-14 yr BP) and we argue that they record vigorous episodes of activity of the M'Clure Strait Ice Stream. The timing of these events is remarkably similar to the North Atlantic's Heinrich events and we take this as evidence that the M'Clure Strait Ice Stream was also activated around the same time. This may hold important implications for tile cause of the North Atlantic's Heinrich events and hints at tile possibility of a pall-ice sheet response. (c) 2005 Elsevier B.V. All rights reserved.

Efeito dos ácidos graxos ômega-3, ômega-6 e ômega-9 sobre o risco cardiovascular de indivíduos adultos: estudo clínico de prevenção primária.

INTRODUÇÃO: As doenças cardiovasculares (DCV) são a principal causa de morte no mundo, sendo muitos dos fatores de risco passíveis de prevenção e controle. Embora as DCV sejam complexas em sua etiologia e desenvolvimento, a concentração elevada de LDL-c e baixa de HDL-c constituem os fatores de risco modificáveis mais monitorados na prática clínica, embora não sejam capazes de explicar todos os eventos cardiovasculares. Portanto, investigar como intervenções farmacológicas e nutricionais podem modular parâmetros oxidativos, físicos e estruturais das lipoproteínas pode fornecer estimativa adicional ao risco cardiovascular. Dentre os diversos nutrientes e compostos bioativos relacionados às DCV, os lipídeos representam os mais investigados e descritos na literatura. Nesse contexto, os ácidos graxos insaturados (ômega-3, ômega-6 e ômega-9) têm sido foco de inúmeros estudos. OBJETIVOS: Avaliar o efeito da suplementação com ômega-3, ômega-6 e ômega-9 sobre os parâmetros cardiometabólicos em indivíduos adultos com múltiplos fatores de risco e sem evento cardiovascular prévio. MATERIAL E MÉTODOS: Estudo clínico, randomizado, duplo-cego, baseado em intervenção nutricional (3,0 g/dia de ácidos graxos) sob a fórmula de cápsulas contendo: ômega-3 (37 por cento de EPA e 23 por cento de DHA) ou ômega-6 (65 por cento de ácido linoleico) ou ômega-9 (72 por cento de ácido oleico). A amostra foi composta por indivíduos de ambos os sexos, com idade entre 30 e 74 anos, apresentando pelo menos um dos seguintes fatores de risco: Dislipidemia, Diabetes Mellitus, Obesidade e Hipertensão Arterial Sistêmica. Após aprovação do Comitê de Ética, os indivíduos foram distribuídos nos três grupos de intervenção. No momento basal, os indivíduos foram caracterizados quanto aos aspectos demográficos (sexo, idade e etnia) e clínicos (medicamentos, doenças atuais e antecedentes familiares). Nos momentos basal e após 8 semanas de intervenção, amostras de sangue foram coletadas após 12h de jejum. A partir do plasma foram analisados: perfil lipídico (CT, LDL-c, HDL-c, TG), apolipoproteínas AI e B, ácidos graxos não esterificados, atividade da PON1, LDL(-) e auto-anticorpos, ácidos graxos, glicose, insulina, tamanho e distribuição percentual da LDL (7 subfrações e fenótipo A e não-A) e HDL (10 subfrações). O efeito do tempo, da intervenção e associações entre os ácidos graxos e aspectos qualitativos das lipoproteínas foram testados (SPSS versão 20.0, p <0,05). RESULTADOS: Uma primeira análise dos resultados baseada em um corte transversal demonstrou, por meio da análise de tendência linear ajustada pelo nível de risco cardiovascular, que o maior tercil plasmático de DHA se associou positivamente com HDL-c, HDLGRANDE e tamanho de LDL e negativamente com HDLPEQUENA e TG. Observou-se também que o maior tercil plasmático de ácido linoleico se associou positivamente com HDLGRANDE e tamanho de LDL e negativamente com HDLPEQUENA e TG. Esse perfil de associação não foi observado quando foram avaliados os parâmetros dietéticos. Avaliando uma subamostra que incluiu indivíduos tabagistas suplementados com ômega-6 e ômega-3, observou-se que ômega-3 modificou positivamente o perfil lipídico e as subfrações da HDL. Nos modelos de regressão linear ajustados pela idade, sexo e hipertensão, o DHA plasmático apresentou associações negativas com a HDLPEQUENA. Quando se avaliou exclusivamente o efeito do ômega-3 em indivíduos tabagistas e não tabagistas, observou-se que fumantes, do sexo masculino, acima de 60 anos de idade, apresentando baixo percentual plasmático de EPA e DHA (<8 por cento ), com excesso de peso e gordura corporal elevada, apresentam maior probabilidade de ter um perfil de subfrações de HDL mais aterogênicas. Tendo por base os resultados acima, foi comparado o efeito do ômega-3, ômega-6 e ômega-9 sobre os parâmetros cardiometabólicos. O ômega-3 promoveu redução no TG, aumento do percentual de HDLGRANDE e redução de HDLPEQUENA. O papel cardioprotetor do ômega-3 foi reforçado pelo aumento na incorporação de EPA e DHA, no qual indivíduos com EPA e DHA acima de 8 por cento apresentaram maior probabilidade de ter HDLGRANDE e menor de ter HDLPEQUENA. Em adição, observou-se também que o elevado percentual plasmático de ômega-9 se associou com partículas de LDL menos aterogênicas (fenótipo A). CONCLUSÃO: Ácidos graxos plasmáticos, mas não dietéticos, se correlacionam com parâmetros cardiometabólicos. A suplementação com ômega-3, presente no óleo de peixe, promoveu redução no TG e melhoria nos parâmetros qualitativos da HDL (mais HDLGRANDE e menos HDLPEQUENA). Os benefícios do ômega-3 foram particularmente relevantes nos indivíduos tabagistas e naqueles com menor conteúdo basal de EPA e DHA plasmáticos. Observou-se ainda que o ômega-9 plasmático, presente no azeite de oliva, exerceu impacto positivo no tamanho e subfrações da LDL.

Otimização das condições de produção de ésteres etílicos a partir de óleo de peixe com elevado teor de ácidos graxos ômega-3

The production of ethyl esters by alcoholysis is an alternative for splitting triacylglycerols due to the possibility of using low temperatures, which results in oxidative protection of the polyunsaturated fatty acids. Ethyl esters produced under mild conditions of temperature could be used as substrate for obtaining structured lipids. The reaction parameters of production of ethyl esters from fish oil with high content of omega-3 fatty acids by alcoholysis were optimized using response surface methodology. An experimental design (2³) (with levels +1 and -1, six axial points with levels -alpha and +alpha and three central points) was applied. The variables investigated were concentration of catalyst, amount of ethyl alcohol and temperature. Ethyl ester conversion was monitored by high performance size exclusion chromatography (HPSEC) and the best result obtained was 95% conversion rate. The optimal conditions were 40 °C, 1% of NaOH and 36% of ethanol.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Comparative analysis of adverse events between infliximab and adalimumab in Crohn's disease management: a Brazilian single-centre experience

INTRODUCTION: Data is scarce regarding adverse events (AE) of biological therapy used in the management of Crohn's Disease (CD) among Brazilian patients. OBJECTIVES: To analyse AE prevalence and profile in patients with CD treated with Infliximab (IFX) or Adalimumab (ADA) and to verify whether there are differences between the two drugs. METHOD: Retrospective observational single-centre study of CD patients on biological therapy. Variables analysed: Demographic data, Montreal classification, biological agent administered, treatment duration, presence and type of AE and the need for treatment interruption. RESULTS: Forty-nine patients were analysed, 25 treated with ADA and 24 with IFX. The groups were homogeneous in relation to the variables studied. The average follow-up period for the group treated with ADA was 19.3 months and 21.8 months for the IFX group (p = 0.585). Overall, 40% (n = 10) of patients taking ADA had AE compared with 50% (n = 12) of IFX users (p = 0.571). There was a tendency towards higher incidence of cutaneous and infusion reactions in the IFX group and higher incidence of infections in the ADA treated group, although without significant difference. CONCLUSIONS: No difference was found in the AE prevalence and profile between ADA and IFX CD patients in the population studied.

Effects of a novel calcium aluminate cement on the early events of the progression of osteogenic cell cultures

The present study evaluated the progression of osteogenic cell cultures exposed to a novel calcium aluminate cement (CAC+) in comparison with the gold standard mineral trioxide aggregate (MTA). Cells were enzimatically isolated from newborn rat calvarial bone, plated on glass coverslips containing either CAC+ or a control MTA samples in the center, and grown under standard osteogenic conditions. Over the 10-day culture period, roundening of sample edges was clearly noticed only for MTA group. Although both cements supported osteogenic cell adhesion, spreading, and proliferation, CAC+-exposed cultures showed significantly higher values in terms of total cell number at days 3 and 7, and total protein content and alkaline phosphatase activity at day 10. The present in vitro results indicate that the exposure to CAC+ supports a higher differentiation of osteogenic cells compared with the ones exposed to MTA. Further experimental studies should consider CAC+ as a potential alternative to MTA when the repair of mineralized tissues is one of the desired outcomes in endodontic therapy.

Engagement of multifocal neural circuits during recall of autobiographical happy events

Happy emotional states have not been extensively explored in functional magnetic resonance imaging studies using autobiographic recall paradigms. We investigated the brain circuitry engaged during induction of happiness by standardized script-driven autobiographical recall in 11 healthy subjects (6 males), aged 32.4 ± 7.2 years, without physical or psychiatric disorders, selected according to their ability to vividly recall personal experiences. Blood oxygen level-dependent (BOLD) changes were recorded during auditory presentation of personal scripts of happiness, neutral content and negative emotional content (irritability). The same uniform structure was used for the cueing narratives of both emotionally salient and neutral conditions, in order to decrease the variability of findings. In the happiness relative to the neutral condition, there was an increased BOLD signal in the left dorsal prefrontal cortex and anterior insula, thalamus bilaterally, left hypothalamus, left anterior cingulate gyrus, and midportions of the left middle temporal gyrus (P < 0.05, corrected for multiple comparisons). Relative to the irritability condition, the happiness condition showed increased activity in the left insula, thalamus and hypothalamus, and in anterior and midportions of the inferior and middle temporal gyri bilaterally (P < 0.05, corrected), varying in size between 13 and 64 voxels. Findings of happiness-related increased activity in prefrontal and subcortical regions extend the results of previous functional imaging studies of autobiographical recall. The BOLD signal changes identified reflect general aspects of emotional processing, emotional control, and the processing of sensory and bodily signals associated with internally generated feelings of happiness. These results reinforce the notion that happiness induction engages a wide network of brain regions.

High-energy events and short-term changes in superficial beach sediments

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Surveillance for adverse events after DTwP/Hib vaccination in Brazil: sensitivity and factors associated with reporting

We estimated the sensitivity, i.e., the proportion of all cases of adverse events following immunization (AEFIs) reported to the Brazilian passive surveillance for adverse events following immunization (PSAEFI) with the diphtheria-tetanus-whole-cell pertussis-Haemophilus influenzae type b (DTwP-Hib) vaccine, as well as investigating factors associated with AEFIs reporting. During 2003–2004, 8303 AEFIs associated with DTwP-Hib were reported; hypotonic-hyporesponsive episodes (HHEs), fever and convulsions being the most common. Cure without sequel was achieved in 98.4 per cent of the cases. The mean sensitivity of the PSAEFI was 22.3 per cent and 31.6 per cent, respectively, for HHE and convulsions, varying widely among states. Reporting rates correlated positively with the Human Development Index and coverage of adequate prenatal care, correlating negatively with infant mortality rates. Quality of life indicators and the degree of organization of health services are associated with greater PSAEFI sensitivity. In addition to consistently describing the principal AEFIs, PSAEFI showed the DTwP/Hib vaccine to be safe and allayed public fears related to its use

Genetic Variants of Diabetes Risk and Incident Cardiovascular Events in Chronic Coronary Artery Disease

Objective: To determine whether information from genetic risk variants for diabetes is associated with cardiovascular events incidence. Methods: From the about 30 known genes associated with diabetes, we genotyped single-nucleotide polymorphisms at the 10 loci most associated with type-2 diabetes in 425 subjects from the MASS-II Study, a randomized study in patients with multi-vessel coronary artery disease. The combined genetic information was evaluated by number of risk alleles for diabetes. Performance of genetic models relative to major cardiovascular events incidence was analyzed through Kaplan-Meier curve comparison and Cox Hazard Models and the discriminatory ability of models was assessed for cardiovascular events by calculating the area under the ROC curve. Results: Genetic information was able to predict 5-year incidence of major cardiovascular events and overall-mortality in non-diabetic individuals, even after adjustment for potential confounders including fasting glycemia. Non-diabetic individuals with high genetic risk had a similar incidence of events then diabetic individuals (cumulative hazard of 33.0 versus 35.1% of diabetic subjects). The addition of combined genetic information to clinical predictors significantly improved the AUC for cardiovascular events incidence (AUC = 0.641 versus 0.610). Conclusions: Combined information of genetic variants for diabetes risk is associated to major cardiovascular events incidence, including overall mortality, in non-diabetic individuals with coronary artery disease.