Carrying and Effect of Granulated Baits Formulated with Entomopathogenic Fungi among Atta sexdens rubropilosa Colonies (Hymenoptera: Formicidae)

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Interaction Between the Predator Podisus nigrispinus (Hemiptera: Pentatomidae) and the Entomopathogenic Bacteria Bacillus thuringiensis

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

First record of infection by entomopathogenic nematodes of the grass bug Collaria scenica Stal (Hemiptera: Miridae).

NARANJO N, MONTERO DAV, SAENZ APONTE A. 2011. First record of infection by entomopathogenic nematodes of the grass bug Collaria scenica Stal (Hemiptera: Miridae). ENTOMOTROPICA 26(3): 117-125. The study was aimed to test the pathogenicity of Steinernema sp. and Heterorhabditis sp. in Collaria scenica. The effect of different concentrations of infective juveniles (IJ) were tested on nymphs and adults of C. scenica. For this purpose, the bugs were inoculated with 5 000 JI of each nematode species in a factorial design (3x2), and seven concentrations were tested in a JI factorial design (7x2x2). The bugs showed 100% mortality and symptoms of pathogenicity. Infection was found with both species of nematodes and penetration was assumed to be through the spiracles and anus. A higher capacity of pathogenicity was observed with Steinernema sp. Based on the results Heterorhabditis sp. and Steinernema sp. could constitute an efficient tool to control populations of C. scenica in pastures.

Spray Nozzles, Pressures, Additives and Stirring Time on Viability and Pathogenicity of Entomopathogenic Nematodes (Nematoda: Rhabditida) for Greenhouses

The objective of this study was to evaluate different strategies for the application of entomopathogenic nematodes (EPN). Three different models of spray nozzles with air induction (AI 11003, TTI 11003 and AD-IA 11004), three spray pressures (207, 413 and 720 kPa), four different additives for tank mixtures (cane molasses, mineral oil, vegetable oil and glycerin) and the influence of tank mixture stirring time were all evaluated for their effect on EPN (Steinernema feltiae) viability and pathogenicity. The different nozzles, at pressures of up to 620 kPa, were found to be compatible with S. feltiae. Vegetable oil, mineral oil and molasses were found to be compatible adjuvants for S. feltiae, and stirring in a motorized backpack sprayer for 30 minutes did not impact the viability or pathogenicity of this nematode. Appropriate techniques for the application of nematodes with backpack sprayers are discussed. © 2013 Moreira et al.

Virulence of entomopathogenic nematodes (Rhabditida: Steinernematidae, Heterorhabditidae) to spittlebug Mahanarva spectabilis (Hemiptera: Cercopidae)

A cigarrinha-das-pastagens pode causar sérias limitações na produção de forragens, e o uso de produtos químicos para o controle é caro, além de poder prejudicar o ambiente. Então, existe a necessidade de reduzir o uso de agentes químicos através do desenvolvimento de novas estratégias de controle dessa praga. A virulência de nove isolados de nematoides entomopatogênicos (NEPs) sobre a cigarrinha-das-pastagens foi avaliada em condições de laboratório e casa-de-vegetação. Ninfas de quarto/quinto ínstar de Mahanarva spectabilis foram expostas aos isolados de NEPs em laboratório, e os mais virulentos foram aplicados sobre as ninfas em casa-de-vegetação sob as concentrações de 2000 e 4000 JIs/mL. A eficácia do agente patogênico foi confirmada pela dissecação dos hospedeiros mortos. Todos os isolados testados foram patogênicos às ninfas da cigarrinha-das-pastagens em laboratório, particularmente Steinernema carpocapsae, S. feltiae, S. riobrave e Heterorhabditis amazonensis RSC1, cada um deles causando mortalidade maior que 80%. A concentração não influenciou a eficiência, exceto para S. carpocapsae, o qual não foi tão efetivo como os demais em casa-de-vegetação. Nematoides entomopatogênicos podem ser incluídos em programas de manejo integrado de M. spectabilis.

Interactions Between the Entomopathogenic Fungi Beauveria bassiana (Ascomycota: Hypocreales) and the Aphid Parasitoid Diaeretiella rapae (Hymenoptera: Braconidae) on Myzus persicae (Hemiptera: Aphididae)

The interactions between the entomopathogenic fungus Beauveria bassiana (Balsamo-Crivelli) Vuillemin (Ascomycota: Hypocreales) and the aphid parasitoid Diaeretiella rapae McIntoch (Hymenoptera: Braconidae) were evaluated under laboratory conditions. Nymphs of Myzus persicae Sulzer (Hemiptera: Aphididae) were first exposed to parasitoid females for 24 h and then 0, 24, and 48 h afterwards sprayed with a solution of B. bassiana. Likewise, aphids were also sprayed with B. bassiana and then exposed to parasitoids at 0, 24, and 48 h afterwards. Parasitism rate varied from 13 to 66.5%, and were signi_cantly lower in treatments where the two agents were exposed within a 0-24 h time interval compared with the control (without B. bassiana). Parasitoid emergence was negatively affected in treatments with B. bassiana spraying and subsequent exposure to D. rapae. Decreases in longevity of adult females of the D. rapae F1 generation were observed in treatments with B. bassiana spraying. The application of these two biological control agents can be used in combination on the control of M. persicae, wherein this use requires effective time management to avoid antagonistic interactions.

Taxonomic studies of laelapid mites (Acari: Mesostigmata: Laelapidae) and their use in combination with entomopathogenic nematodes (Rhabditida: Steinernematidae, Heterorhabditidae) to control Frankliniella occidentalis (Thysanoptera: Thripidae)

Pós-graduação em Agronomia (Entomologia Agrícola) - FCAV

Population trends of the red palm mite, raoiella indica hirst (acari: tenuipalpidae) and associated entomopathogenic fungi in trinidad, antigua, st kitts and nevis and dominica

A survey to determine population trends and entomopathogenic fungi associated with the red palm mite (RPM), Raoiella indica, was conducted in Trinidad, Antigua, St. Kitts and Nevis and Dominica. RPM population density was evaluated by sampling a total of ten coconut palms per site in Antigua, St. Kitts and Nevis, Dominica, and Trinidad (Manzanilla and Icacos). Mites from the four islands were either surface sterilized or left unsterilized before being cultured on Tap Water Agar (TWA). A total of 318 fungal colonies were retrieved. A further 96 mites from Dominica were kept on sterile moist filter paper in a humidity chamber and a further 85 colonies were isolated. Based on morphological observations of all 403 isolates, a sample consisting of 32 colonies (8 %) was sent for identification at CABI-UK. Of the 27 fungi positively identified, 15 isolates belonged to the genera Cladosporium, three to Simplicillium spp., and one to Penicillium. Other fungi genera with limited or no entomopathogenic potential included: Aspergillus, Cochliobolus, Fusarium, Pestalotiopsis and Pithomyces. The results show a potential use of entomopathogenic fungi for population management of the red palm mite in the Caribbean region.

Susceptibility of Aethina tumida (Coleoptera: Nitidulidae) Larvae and Pupae to Entomopathogenic Nematodes

In this study, we evaluated the potential use of entomopathogenic nematodes as a control for the beetle Aethina tumida Murray (Coleoptera: Nitidulidae). In particular, we conducted 1) four screening bioassays to determine nematode (seven species, 10 total strains tested) and application level effects on A. tumida larvae and pupae, 2) a generational persistence bioassay to determine whether single inoculations with nematodes would control multiple generations of A. tumida larvae in treated soil, and 3) a field bioassay to determine whether the nematodes would remain efficacious in the field. In the screening bioassays, nematode efficacy varied significantly by tested nematode and the infective juvenile (IJ) level at which they were applied. Although nematode virulence was moderate in screening bioassays 1-3 (0 - 68% A. tumida mortality), A. tumida mortality approached higher levels in screening bioassay 4 (nearly 100% after 39 d) that suggest suitable applicability of some of the test nematodes as field controls for A. tumida. In the generational persistence bioassay, Steinernema Hobrave Cabanillas, Poinar & Raulston 7-12 strain and Heterorhabditis indica Poinar, Karunaka & David provided adequate A. tumida control for 19 wk after a single soil inoculation (76-94% mortality in A. tumida pupae). In the field bioassay, the same two nematode species also showed high virulence toward pupating A. tumida (88-100%) mortality. Our data suggest that nematode use may be an integral component of an integrated pest management scheme aimed at reducing A. tumida populations in bee colonies to tolerable levels.

Characterization of a new toxin from the entomopathogenic fungus Metarhizium anisopliae: the ribotoxin anisoplin

Metarhizium anisopliae is an entomopathogenic fungus relevant in biotechnology with applications like malaria vector control. Studies of its virulence factors are therefore of great interest. Fungal ribotoxins are toxic ribonucleases with extraordinary efficiency against target ribosomes and suggested as potential insecticides. Here, we describe this ribotoxin characteristic activity in M. anisopliae cultures. Anisoplin has been obtained as a recombinant protein and further characterized. It is structurally similar to hirsutellin A, the ribotoxin from the entomopathogen Hirsutella thompsonii. Moreover, anisoplin shows the ribonucleolytic activity typical of ribotoxins and cytotoxicity against insect cells. How Metarhizium uses this toxin and possible applications are on perspective.

Characterization of a new toxin from the entomopathogenic fungus Metarhizium anisopliae: the ribotoxin anisoplin

Metarhizium anisopliae is an entomopathogenic fungus relevant in biotechnology with applications like malaria vector control. Studies of its virulence factors are therefore of great interest. Fungal ribotoxins are toxic ribonucleases with extraordinary efficiency against target ribosomes and suggested as potential insecticides. Here, we describe this ribotoxin characteristic activity in M. anisopliae cultures. Anisoplin has been obtained as a recombinant protein and further characterized. It is structurally similar to hirsutellin A, the ribotoxin from the entomopathogen Hirsutella thompsonii. Moreover, anisoplin shows the ribonucleolytic activity typical of ribotoxins and cytotoxicity against insect cells. How Metarhizium uses this toxin and possible applications are on perspective.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Fungal pathogens as classical biological control agents against arthropods

Fungal entomopathogens have been used more frequently than other types of pathogens for classical biological control. Among 136 programs using different groups of arthropod pathogens, 49.3% have introduced fungal pathogens (including both the traditional fungi and microsporidia). The most commonly introduced species was Metarhizium anisopliae (Metschnikoff) Sorokin, with 13 introductions, followed by Entomophaga maimaiga Humber, Shimazu & Soper, which was released seven times. The majority of introduction programs have focused on controlling invasive species of insects or mites (70.7%) rather than on native hosts (29.4%). Almost half of the introductions of traditional fungi targeted species of Hemiptera and 75% of the microsporidia introduced have been introduced against lepidopteran species. The United States was the country where most introductions of fungi took place (n = 24). From 1993 to 2007, no arthropod pathogens were released in the US due to the rigorous regulatory structure, but in 2008 two species of microsporidia were introduced against the gypsy moth, Lymantria dispar (L.). Establishment of entomopathogenic fungi in programs introducing traditional fungi was 32.1% and establishment was 50.0% for programs introducing microsporidia. In some programs, releases have resulted in permanent successful establishment with no non-target effects. In summary, classical biological control using fungal entomopathogens can provide a successful and environmentally friendly avenue for controlling arthropod pests, including the increasing numbers of invasive non-native species.

Molecular detection and differentiation of Brazilian and African isolates of the entomopathogen Neozygites tanajoae (Entomophthorales: Neozygitaceae) with PCR using specific primers

Neozygites tanajoae is an entomopathogenic fungus which has been used for biocontrol of the cassava green mite (Mononychellus tanajoa, CGM) in Africa. Establishment and dispersal of Brazilian isolates which have been introduced into some African countries in recent years to improve CGM control was followed with specific PCR assays. Two primer pairs, NEOSSU_F/NEOSSU_R and 8DDC_F/8DDC_R, were used to differentiate isolates collected from several locations in Brazil and from three countries in Africa, Benin, Ghana and Tanzania. The first primer pair enabled the species-specific detection of Neozygites tanajoae, while the second differentiated the Brazilian isolates from those of other geographical origin. PCR assays were designed for detection of fungal DNA in the matrix of dead infested mites since N. tanajoae is difficult to isolate and culture on selective artificial media. Our results show that all isolates (Brazilian and African) that sporulated on mummified mites were amplified with the first primer pair confirming their Neozygites tanajoae identity. The second pair amplified DNA from all the Brazilian isolates, but did not amplify any DNA samples from the African isolates. None of the two primers showed amplification neither from any of the non-sporulating mite extracts nor from the dead uninfected mites used as negative controls. We confirmed that the two primer pairs tested are suitable for the detection and differential identification of N. tanajoae isolates from Brazil and Africa and that they are useful to monitor the establishment and spread of the Brazilian isolates of N. tanajoae introduced into Benin or into other African countries for improvement of CGM biocontrol.

Determination of the median lethal concentration (LC(50)) of mycoinsecticides for the control of Ceratitis capitata (Diptera: Tephritidae)

The aim of this study was to determine the median lethal concentration (LC(50)) of the commercial products Boveril WP (R) (Beauveria bassiana) and Metarril WP (R) (Metarhizium anisopliae) on the larvae and pupae of the fruit Ceratitis capitata. Insects used in this study came from a laboratory colony. The evaluated product concentrations were 10.00, 15.00, 20.00 and 25.00 g/L of water, which correspond, respectively, to 5.00x10(9), 7.50x10(9), 10.00x10(9) and 12.50x10(9) viable conidia/L of water for the two products, and in the control only water was applied. Third instar larvae and pupae of C. capitata were used in this study. Results showed an overall mortality of larvae with all conidial concentrations of M. anisopliae. The LC(50) values for larvae were 2.99 and 2.97 g/L for Boveril (R) and Metarril (R), respectively, while for pupae they were 3.12 and 4.74 g/L for Boveril (R) and Metarril (R), respectively. The high pathogenicity demonstrated by lower conidial concentrations of the tested products may mean greater efficiency from both economic and environmental points of view.