Identification of Mycobacteria by Thin Layer Chromatographic Analysis of Mycolic Acids and Conventional Biochemical Method: Four Years of Experience

Mycolic acids analysis by thin-layer chromatography (TLC) has been employed by several laboratories worldwide as a method for fast identification of mycobacteria. This method was introduced in Brazil by our laboratory in 1992 as a routine identification technique. Up to the present, 861 strains isolated were identified by mycolic acids TLC and by standard biochemical tests; 61% out of these strains came as clinical samples, 4% isolated from frogs and 35% as environmental samples. Mycobacterium tuberculosis strains identified by classical methods were confirmed by their mycolic acids contents (I, III and IV). The method allowed earlier differentiation of M. avium complex - MAC (mycolic acids I, IV and VI) from M. simiae (acids I, II and IV), both with similar biochemical properties. The method also permitted to distinguish M. fortuitum (acids I and V) from M. chelonae (acids I and II) , and to detect mixed mycobacterial infections cases as M. tuberculosis with MAC and M. fortuitum with MAC. Concluding, four years experience shows that mycolic acids TLC is an easy, reliable, fast and inexpensive method, an important tool to put together conventional mycobacteria identification methods.

Proteomics fingerprinting of phagosome maturation and evidence for the role of a Galpha during uptake.

Phagocytosis, whether of food particles in protozoa or bacteria and cell remnants in the metazoan immune system, is a conserved process. The particles are taken up into phagosomes, which then undergo complex remodeling of their components, called maturation. By using two-dimensional gel electrophoresis and mass spectrometry combined with genomic data, we identified 179 phagosomal proteins in the amoeba Dictyostelium, including components of signal transduction, membrane traffic, and the cytoskeleton. By carrying out this proteomics analysis over the course of maturation, we obtained time profiles for 1,388 spots and thus generated a dynamic record of phagosomal protein composition. Clustering of the time profiles revealed five clusters and 24 functional groups that were mapped onto a flow chart of maturation. Two heterotrimeric G protein subunits, Galpha4 and Gbeta, appeared at the earliest times. We showed that mutations in the genes encoding these two proteins produce a phagocytic uptake defect in Dictyostelium. This analysis of phagosome protein dynamics provides a reference point for future genetic and functional investigations.

IS6110 fingerprinting of sensitive and resistant strains (1991-1992) of Mycobacterium tuberculosis in Colombia

The standardized method to study the polymorphism of IS 6110 was used to characterize 53 isolates of Mycobacterium tuberculosis obtained during 1991-1992 from 14 regions in Colombia. In Valle region cluster rate was 25% (4/16). The mean number of IS6110 band was 10 ± 3. Similarity between strains was of 60% in 81% of strains and this tended to be correlated with geographic origin. For the first time M. tuberculosis without IS6110 bands in restriction fragment length polymorphism analysis was found in Colombia. Additional studies are necessaries in order to best characterize the situation in relation to human immunodeficiency virus epidemic and recent changes in tuberculosis control program.

Genetic relationships between sympatric populations of Bacillus cereus and Bacillus thuringiensis, as revealed by rep-PCR genomic fingerprinting

The bacterial strain Bacillus cereus is closely related to Bacillus thuringiensis, although any genetic relationship between the two strains is still in debate. Using rep-PCR genomic fingerprinting, we established the genetic relationships between Brazilian sympatric populations of B. cereus and B. thuringiensis simultaneously collected from two geographically separate sites. We observed the formation of both B. thuringiensis and B. cereus clusters, as well as strains of B. cereus that are more closely related to B. thuringiensis than to other B. cereus strains. In addition, lower genetic variability was observed among B. thuringiensis clusters compared to B. cereus clusters, indicating that either the two species should be categorized as separate or that B. thuringiensis may represent a clone from a B. cereus background.

The implementation of liquid chromatography tandem mass spectrometry for the official control of lipophilic toxins in seafood: Single-laboratory validation under four chromatographic conditions

We performed a comprehensive study to assess the fit for purpose of four chromatographic conditions for the determination of six groups of marine lipophilic toxins (okadaic acid and dinophysistoxins, pectenotoxins, azaspiracids, yessotoxins, gymnodimine and spirolides) by LC-MS/MS to select the most suitable conditions as stated by the European Union Reference Laboratory for Marine Biotoxins (EURLMB). For every case, the elution gradient has been optimized to achieve a total run-time cycle of 12 min. We performed a single-laboratory validation for the analysis of three relevant matrices for the seafood aquaculture industry (mussels, pacific oysters and clams), and for sea urchins for which no data about lipophilic toxins have been reported before. Moreover, we have compared the method performance under alkaline conditions using two quantification strategies: the external standard calibration (EXS) and the matrix-matched standard calibration (MMS). Alkaline conditions were the only scenario that allowed detection windows with polarity switching in a 3200 QTrap mass spectrometer, thus the analysis of all toxins can be accomplished in a single run, increasing sample throughput. The limits of quantification under alkaline conditions met the validation requirements established by the EURLMB for all toxins and matrices, while the remaining conditions failed in some cases. The accuracy of the method and the matrix effects where generally dependent on the mobile phases and the seafood species. The MMS had a moderate positive impact on method accuracy for crude extracts, but it showed poor trueness for seafood species other than mussels when analyzing hydrolyzed extracts. Alkaline conditions with EXS and recovery correction for OA were selected as the most proper conditions in the context of our laboratory. This comparative study can help other laboratories to choose the best conditions for the implementation of LC-MS/MS according to their own necessities.

DNA fingerprinting of glioma cell lines and considerations on similarity measurements.

Glioma cell lines are an important tool for research in basic and translational neuro-oncology. Documentation of their genetic identity has become a requirement for scientific journals and grant applications to exclude cross-contamination and misidentification that lead to misinterpretation of results. Here, we report the standard 16 marker short tandem repeat (STR) DNA fingerprints for a panel of 39 widely used glioma cell lines as reference. Comparison of the fingerprints among themselves and with the large DSMZ database comprising 9 marker STRs for 2278 cell lines uncovered 3 misidentified cell lines and confirmed previously known cross-contaminations. Furthermore, 2 glioma cell lines exhibited identity scores of 0.8, which is proposed as the cutoff for detecting cross-contamination. Additional characteristics, comprising lack of a B-raf mutation in one line and a similarity score of 1 with the original tumor tissue in the other, excluded a cross-contamination. Subsequent simulation procedures suggested that, when using DNA fingerprints comprising only 9 STR markers, the commonly used similarity score of 0.8 is not sufficiently stringent to unambiguously differentiate the origin. DNA fingerprints are confounded by frequent genetic alterations in cancer cell lines, particularly loss of heterozygosity, that reduce the informativeness of STR markers and, thereby, the overall power for distinction. The similarity score depends on the number of markers measured; thus, more markers or additional cell line characteristics, such as information on specific mutations, may be necessary to clarify the origin.

Typing Candida albicans oral isolates from human immunodeficiency virus-infected patients by multilocus enzyme electrophoresis and DNA fingerprinting.

A total of 189 Candida albicans isolates have been typed by multilocus enzyme electrophoresis. The results obtained confirm the clonal mode of reproduction of C. albicans. The C. albicans populations found in the oropharynx of human immunodeficiency virus (HIV)-infected patients, in the oropharynx of healthy carriers, or in association with invasive candidiasis could not be distinguished. No clone or group of clones could be associated with the appearance of clinical disorders or with a reduced in vitro susceptibility to the antifungal agent fluconazole. Multiple and sequential oral isolates from 24 HIV-infected patients were also typed by restriction enzyme analysis with the enzymes EcoRI and HinfI and by use of the Ca3 repetitive probe. The results obtained by the combination of all three typing methods show that all but one patient each carried a unique major C. albicans clone in their oropharynx. The 21 patients with sequential isolates had the same C. albicans clones in their throats during recurrent oropharyngeal candidiasis episodes, independently of clinical status or of changes of in vitro susceptibility to fluconazole. Finally, several isolates of the same C. albicans clone found simultaneously in the oropharynx of a patient may present different levels of susceptibility to fluconazole.

Two-step chromatographic purification of human plasma alpha(1)-acid glycoprotein: its application to the purification of rare phenotype samples of the protein and their study by chromatography on immobilized metal chelate affinity adsorbent.

Alpha1-Acid glycoprotein (AAG) or orosomucoid was purified to homogeneity from human plasma by a separate two-step method using chromatography on immobilized Cibacron Blue F3G-A to cross-linked agarose and chromatography on hydroxyapatite. The conditions for the pre-purification of AAG by chromatography on immobilized Cibacron Blue F3G-A were first optimized using different buffer systems with different pH values. The overall yield of the combined techniques was 80% and ca. 12 mg of AAG were purified from an initial total amount of ca. 15 mg in a ca. 40 ml sample of human plasma. This method was applied to the purification of AAG samples corresponding to the three main phenotypes of the protein (FI*S/A, F1/A and S/A), from individual human plasma previously phenotyped for AAG. A study by isoelectric focusing with carrier ampholytes showed that the microheterogeneity of the purified F1*S/A, F1/A and S/A AAG samples was similar to that of AAG in the corresponding plasma, thus suggesting that no apparent desialylation of the glycoprotein occurred during the purification steps. This method was also applied to the purification of AAG samples corresponding to rare phenotypes of the protein (F1/A*AD, S/A*X0 and F1/A*C1) and the interactions of these variants with immobilized copper(II) ions were then studied at pH 7, by chromatography on an iminodiacetate Sepharose-Cu(II) gel. It was found that the different variants encoded by the first of the two genes coding for AAG in humans (i.e. the F1 and S variants) interacted non-specifically with the immobilized ligand, whereas those encoded by the second gene of AAG (i.e. the A, AD, X0 and C1 variants) strongly bound to immobilized Cu(II) ions. These results suggested that chromatography on an immobilized affinity Cu(II) adsorbent could be helpful to distinguish between the respective products of the two highly polymorphic genes which code for human AAG.

Performance of a chromatographic procedure used in the certification of reference material for polycyclic aromatic hydrocarbons in sewage sludge

Semi-automatic capillary gas chromatographic method with classical flame ionization detection, which satisfies the conditions for required performance and gave acceptable results within the framework of an interlaboratory certification programme for PAHs in sewage sludge, is described. The interesting feature of the procedure is that it incorporates automatic operations such as sample fractionation by semi-preparative HPLC, fraction collection at signal level recognition and evaporation under nitrogen flow. Multiple injections in the GC capillary column are performed in the on-column mode via an autosampler with temperature-programmable injector. Automatic data acquisition and chromatogram treatment are made via computer software. This partially automatic procedure releases personnel from tedious and time-consuming tasks and its robust character was validated through the certification of reference material for PAHs in sewage sludge, demonstrating its reliable performance.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Detection of metabolite induction in fungal co-cultures on solid media by high-throughput differential ultra-high pressure liquid chromatography-time-of-flight mass spectrometry fingerprinting.

Access to new biological sources is a key element of natural product research. A particularly large number of biologically active molecules have been found to originate from microorganisms. Very recently, the use of fungal co-culture to activate the silent genes involved in metabolite biosynthesis was found to be a successful method for the induction of new compounds. However, the detection and identification of the induced metabolites in the confrontation zone where fungi interact remain very challenging. To tackle this issue, a high-throughput UHPLC-TOF-MS-based metabolomic approach has been developed for the screening of fungal co-cultures in solid media at the petri dish level. The metabolites that were overexpressed because of fungal interactions were highlighted by comparing the LC-MS data obtained from the co-cultures and their corresponding mono-cultures. This comparison was achieved by subjecting automatically generated peak lists to statistical treatments. This strategy has been applied to more than 600 co-culture experiments that mainly involved fungal strains from the Fusarium genera, although experiments were also completed with a selection of several other filamentous fungi. This strategy was found to provide satisfactory repeatability and was used to detect the biomarkers of fungal induction in a large panel of filamentous fungi. This study demonstrates that co-culture results in consistent induction of potentially new metabolites.

Classification and fingerprinting of different berries based on biochemical profiling and antioxidant capacity

The objective of this work was to evaluate the biochemical composition of six berry types belonging to Fragaria, Rubus, Vaccinium and Ribes genus. Fruit samples were collected in triplicate (50 fruit each) from 18 different species or cultivars of the mentioned genera, during three years (2008 to 2010). Content of individual sugars, organic acids, flavonols, and phenolic acids were determined by high performance liquid chromatography (HPLC) analysis, while total phenolics (TPC) and total antioxidant capacity (TAC), by using spectrophotometry. Principal component analysis (PCA) and hierarchical cluster analysis (CA) were performed to evaluate the differences in fruit biochemical profile. The highest contents of bioactive components were found in Ribes nigrum and in Fragaria vesca, Rubus plicatus, and Vaccinium myrtillus. PCA and CA were able to partially discriminate between berries on the basis of their biochemical composition. Individual and total sugars, myricetin, ellagic acid, TPC and TAC showed the highest impact on biochemical composition of the berry fruits. CA separated blackberry, raspberry, and blueberry as isolate groups, while classification of strawberry, black and red currant in a specific group has not occurred. There is a large variability both between and within the different types of berries. Metabolite fingerprinting of the evaluated berries showed unique biochemical profiles and specific combination of bioactive compound contents.

Influence of stationary phase and eluent properties on chromatographic separation of carbohydrates

In this thesis, the sorption and elastic properties of the cation-exchange resins were studied to explain the liquid chromatographic separation of carbohydrates. Na+, Ca2+ and La3+ form strong poly(styrene-co-divinylbenzene) (SCE) as well as Na+ and Ca2+ form weak acrylic (WCE) cation-exchange resins at different cross-link densities were treated within this work. The focus was on the effects of water-alcohol mixtures, mostly aqueous ethanol, and that of the carbohydrates. The carbohydrates examined were rhamnose, xylose, glucose, fructose, arabinose, sucrose, xylitol and sorbitol. In addition to linear chromatographic conditions, non-linear conditions more typical for industrial applications were studied. Both experimental and modeling aspectswere covered. The aqueous alcohol sorption on the cation-exchangers were experimentally determined and theoretically calculated. The sorption model includes elastic parameters, which were obtained from sorption data combined with elasticity measurements. As hydrophilic materials cation-exchangers are water selective and shrink when an organic solvent is added. At a certain deswelling degree the elastic resins go through glass transition and become as glass-like material. Theincreasing cross-link level and the valence of the counterion decrease the sorption of solvent components in the water-rich solutions. The cross-linkage or thecounterions have less effect on the water selectivity than the resin type or the used alcohol. The amount of water sorbed is higher in the WCE resin and, moreover, the WCE resin is more water selective than the corresponding SCE resin. Theincreased aliphatic part of lower alcohols tend to increase the water selectivity, i.e. the resins are more water selective in 2-propanol than in ethanol solutions. Both the sorption behavior of carbohydrates and the sorption differences between carbohydrates are considerably affected by the eluent composition and theresin characteristics. The carbohydrate sorption was experimentally examined and modeled. In all cases, sorption and moreover the separation of carbohydrates are dominated by three phenomena: partition, ligand exchange and size exclusion. The sorption of hydrophilic carbohydrates increases when alcohol is added into the eluent or when carbohydrate is able to form coordination complexes with the counterions, especially with multivalent counterions. Decreasing polarity of the eluent enhances the complex stability. Size exclusion effect is more prominent when the resin becomes tighter or carbohydrate size increases. On the other hand,the elution volumes between different sized carbohydrates decreases with the decreasing polarity of the eluent. The chromatographic separation of carbohydrateswas modeled, using rhamnose and xylose as target molecules. The thermodynamic sorption model was successfully implemented in the rate-based column model. The experimental chromatographic data were fitted by using only one adjustable parameter. In addition to the fitted data also simulated data were generated and utilized in explaining the effect of the eluent composition and of the resin characteristics on the carbohydrate separation.