931 resultados para Time Rt-pcr


Relevância:

100.00% 100.00%

Publicador:

Resumo:

The aim of this study was to validate the application of a commercially available multiplex reverse transcription polymerase chain reaction (RT-PCR) assay [He-mavision-7 System] for the seven most common leukemia translocations for routine molecular diagnostic hematopathology practice. A total of 98 samples, comprising four groups, were evaluated: Group 1, 16 diagnostic samples molecularly positive by our existing laboratory-developed assays for PML-RARalpha/t (15; 17) or BCR-ABL/t (9;22); Group 2, 51 diagnostic samples negative by our laboratory-developed assays for PML-RARalpha/t (15;17) or BCR-ABL/t (9;22); Group 3, 21 prospectively analyzed diagnostic cases, without prior molecular studies; and Group 4, 10 minimal residual disease (MRD) samples. Analysis of the two previously studied cohorts (Groups 1 and 2) confirmed the diagnostic sensitivity and specificity of the multiplex assay with regard to these two translocations. Additionally, however, in the

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Conflicting results have been reported on the detection of paramyxovirus transcripts in Paget's disease, and a possible explanation is differences in the sensitivity of RT-PCR methods for detecting virus. In a blinded study, we found no evidence to suggest that laboratories that failed to detect viral transcripts had less sensitive RT-PCR assays, and we did not detect measles or distemper transcripts in Paget's samples using the most sensitive assays evaluated.

Introduction: There is conflicting evidence on the possible role of persistent paramyxovirus infection in Paget's disease of bone (PDB). Some workers have detected measles virus (MV) or canine distemper virus (CDV) transcripts in cells and tissues from patients with PDB, but others have failed to confirm this finding. A possible explanation might be differences in the sensitivity of RT-PCR methods for detecting virus. Here we performed a blinded comparison of the sensitivity of different RT-PCR-based techniques for MV and CDV detection in different laboratories and used the most sensitive assays to screen for evidence of viral transcripts in bone and blood samples derived from patients with PDB.

Materials and Methods: Participating laboratories analyzed samples spiked with known amounts of MV and CDV transcripts and control samples that did not contain viral nucleic acids. All analyses were performed on a blinded basis.

Results: The limit of detection for CDV was 1000 viral transcripts in three laboratories (Aberdeen, Belfast, and Liverpool) and 10,000 transcripts in another laboratory (Manchester). The limit of detection for MV was 16 transcripts in one laboratory (NIBSC), 1000 transcripts in two laboratories (Aberdeen and Belfast), and 10,000 transcripts in two laboratories (Liverpool and Manchester). An assay previously used by a U.S.-based group to detect MV transcripts in PDB had a sensitivity of 1000 transcripts. One laboratory (Manchester) detected CDV transcripts in a negative control and in two samples that had been spiked with MV. None of the other laboratories had false-positive results for MV or CDV, and no evidence of viral transcripts was found on analysis of 12 PDB samples using the most sensitive RT-PCR assays for MV and CDV.

Conclusions: We found that RT-PCR assays used by different laboratories differed in their sensitivity to detect CDV and MV transcripts but found no evidence to suggest that laboratories that previously failed to detect viral transcripts had less sensitive RT-PCR assays than those that detected viral transcripts. False-positive results were observed with one laboratory, and we failed to detect paramyxovirus transcripts in PDB samples using the most sensitive assays evaluated. Our results show that failure of some laboratories to detect viral transcripts is unlikely to be caused by problems with assay sensitivity and highlight the fact that contamination can be an issue when searching for pathogens by sensitive RT-PCR-based techniques.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Tesis (Doctora en Ciencias con Especialidad en Biotecnología) U.A.N.L. Facultad de Ciencias Biológicas, 2007.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

A dengue é a mais importante doença viral transmitida por mosquitos, no que diz respeito à morbidade e mortalidade, que afeta os seres humanos. Este vírus é transmitido pelos vetores Aedes albopictus e Aedes aegypti, este último é o principal vetor nas Américas. O controle da doença se baseia na vigilância laboratorial e vigilância entomológica. A vigilância laboratorial visa aprimorar a capacidade do diagnóstico, detectando precocemente a circulação viral e monitorando os sorotipos circulantes. Dentro deste tipo de vigilância, a RT-PCR é um método bastante usado no diagnóstico da doença em humanos e mosquitos, porém, a má conservação do material pode comprometer a integridade do RNA e trazer resultados falso-negativos. O desenvolvimento de melhores métodos de vigilância do vírus dengue (DENV) em mosquitos é de grande valor para os programas de controle. Desta maneira, o presente projeto visou otimizar a técnica de RT-PCR Multiplex para detecção de DENV em amostras de Ae. aegypti infectadas artificialmente pelo vírus. Primers que amplificam uma região de 80 pb do gene rpL8 de mosquito foram desenhados no site Primer3 e avaliados na ferramenta online Multiple Primer Analyzer, junto com primers que amplificam os sorotipos DENV. Não houve competição de primers e foi observado bandas distintas no gel de agarose. Foi avaliado o efeito de diferentes formas de preservação do material genético das amostras (RNAlater®, freezer -80°C e nitrogênio líquido) por 7 dias, onde não houve diferenças significativas em relação à integridade do RNA. O efeito de diferentes formas de extração de RNA (Kit da QIAGEN® , TRIzol® e Chomczymski-Sacchi) também foi avaliado e o método ChomczymskiSacchi obteve o melhor desempenho. A otimização desta técnica permitirá uma maior confiabilidade nos resultados, já que além da detecção dos sorotipos, haverá uma confirmação da qualidade do RNA, aprimorando a capacidade do diagnóstico e auxiliando a prevenção e controle da transmissão da dengue.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

TMV was tried to recover from a variety of branded cigarettes and cigars. Tobacco from six different brands of cigarettes and cigar were processed and reverse transcriptase polymerase chain reaction was employed for the detection of TMV. RTPCR confirmed the presence of TMV in tobacco from one brand of cigarette and one brand of cigar. Bean plants (Phaseolus vulgaris) were inoculated manually with tobacco sap of cigarettes resulting in the production of localized disease lesions. Together, these results showed that tobacco used to make cigarettes and cigars can function as an effective disease vector, potentially aiding the movement of infectious TMV between countries. This is an important finding prompting a need to test smoking tobacco for other virus particles that infect tobacco plants and survive processing as well as considering biosecurity measures to limit virus transmission

Relevância:

100.00% 100.00%

Publicador:

Resumo:

O enrolamento do arroz é uma doença viral emergente no Brasil causada pelo Rice stripe necrosis virus (RSNV) que é transmitido pelo protozoário Polymyxa graminis. RSNV é um membro do gênero Benyvirus com genoma dividido em 4 RNAs de fita simples no sentido positivo (ssRNA +). Em função da falta de conhecimento sobre a seqüência de nucleotídeos do seu genoma, a detecção de RSNV através de métodos moleculares não é utilizada. O objetivo deste trabalho foi identificar seqüências do genoma de RSNV que possibilitassem sua detecção em plantas de arroz através da técnica de transcrição reversa seguida da reação em cadeia da polimerase (RT-PCR). As seqüências do genoma foram identificadas a partir de clones de uma biblioteca de cDNAs obtidos de uma amostra do vírus parcialmente purificado. Os clones que hibridizaram com sondas sintetizadas a partir de RNA de plantas infectadas com RSNV foram seqüenciados e comparados às seqüências do GenBank. Um fragmento de 957 nt da extremidade 3’ da fita de um dos 4 RNAs genômicos de RSNV foi obtido. A análise da seqüência nucleotídeos desse fragmento não revelou qualquer similaridade com seqüências conhecidas, tampouco indicou uma possível função. Um par de oligonucleotídeos iniciadores foi desenhado a partir de um clone que potencialmente contém uma seqüência de RSNV. A especificidade e a sensibilidade da RT-PCR utilizando esse par de oligonucleotídeos iniciadores, bem como sua eficiência na detecção do vírus em diferentes partes da planta de arroz, foram avaliadas. Os resultados indicam que a RT-PCR é específica para RSNV e pode detectar o vírus em tecido oriundo das raízes, do colo e de folhas com distorção. Comparada ao diagnóstico da doença através da observação de sintomas e de estruturas do vetor, a RT-PCR é uma ferramenta confiável para a diagnose do enrolamento do arroz.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

A semi-nested reverse transcription-polymerase chain reaction (Semi-N-RT-PCR) was developed and used to detect the S glycoprotein gene of infectious bronchitis virus (IBV) strains and to discriminate H120 vaccine strain from other strains. Viral RNA was extracted from the allantoic fluid of chicken embryos and from tissues of chickens experimentally infected with different strains of IBV. Amplification and identification of the viral RNA was performed using two sets of primers complementary to a region of the S glycoprotein gene in the Semi-N-RT-PCR assay. The pair of primers used in the first PCR consisted of universal oligonucleotides flanking a more variable region of S1-S2 gene. The second primer pair was used in the Semi-N-RT-PCR and was comprised of one of the primers from the first universal pair together with either another universal internal oligolucleotide or a oligonucleotide sequence specific for the H120 strain of IBV. The universal primers detected all reference IBV strains and field isolates tested herein. The Semi-N-RT-PCR had high sensitivity and specificity, and was able to differentiate the H120 vaccine strain from other reference IBV strains; including M41 strain. All tissue samples collected from chickens experimentally infected with H120 or M41 strains were positive in the semi-nested RT-PCR using universal primers, while only the H120-infected tissue samples were amplified by the set of primers containing the H120-oligonucleotide. In conclusion, the ability of Semi-N-RT-PCR to detect distinct IBV strains and preliminarily discriminate the vaccine strain (H120) closes a diagnostic gap and offers the opportunity to use comprehensive PCR procedures for the IBV diagnosis.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Lettuce mottle virus (LeMoV) and dandelion yellow mosaic virus (DaYMV) infect lettuce in South America and Europe, respectively. LeMoV and DaYMV possess isometric particles, occur at low concentrations in plants and have narrow host ranges. Partial genome sequences of both viruses were obtained using purified viral preparations and universal primers for members of the family Sequiviridae. DaYMV and LeMoV sequences were analyzed and showed identity with other members of the family. Universal primers that detect both viruses and specific primers for LeMoV and DaYMV were designed and used in RT-PCR-based diagnostic assays. These results provide the first molecular data on the LeMoV and DaYMV genomes and suggest that LeMoV is a member of the genus Sequivirus, probably distinct from DaYMV.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)