999 resultados para Specific ultraviolet absorbance (SUVA)
Resumo:
Increases in ultraviolet radiation (UVR) and CO2 affect phytoplankton growth and mortality in a variety of different ways. However, in situ responses of natural phytoplankton communities to climate change, as well as its effects on phytoplankton annual cycles, are still largely unknown. Although temperature and UVR have been increasing in temperate latitudes during winter, this season is still particularly neglected in climate change studies, being considered a non-active season regarding phytoplankton growth and production. Additionally, coastal lagoons are highly productive ecosystems and very vulnerable to climate change. This study aims, therefore, to evaluate the short-term effects of increased UVR and CO2 on the composition and growth of winter phytoplankton assemblages in a temperate coastal lagoon. During winter 2012, microcosm experiments were used to evaluate the isolated and combined effects of UVR and CO2, under ambient and high CO2 treatments, exposed to ambient UV levels and photosynthetically active radiation (PAR), or to PAR only. Phytoplankton composition, abundance, biomass and photosynthetic parameters were evaluated during the experiments. Significant changes were observed in the growth of specific phytoplankton groups, leading to changes in community composition. The cyanobacterium Synechococcus was dominant at the beginning of the experiment, but it was negatively affected by UVR and CO2. Diatoms clearly benefited from high CO2 and UVR, particularly Thalassiosira. Despite the changes observed in specific phytoplankton groups, growth and production of the whole phytoplankton community did not show significant responses to UVR and/or CO2.
Resumo:
The study aimed to unravel the interaction between ocean acidification and solar ultraviolet radiation (UVR) in Chaetoceros curvisetus. Chaetoceros curvisetus cells were acclimated to high CO2 (HC, 1000 ppmv) and low CO2 concentration (control, LC, 380 ppmv) for 14 days. Cell density, specific growth rate and chlorophyll were measured. The acclimated cells were then exposed to PAB (photosynthetically active radiation (PAR) + UV-A + UV-B), PA (PAR + UV-A) or P (PAR) for 60 min. Photochemical efficiency (phi PSII), relative electron transport rate (rETR) and the recovery of ?PSII were determined. HC induced higher cell density and specific growth rate compared with LC. However, no difference was found in chlorophyll between HC and LC. Moreover, phi PSII and rETRs were higher under HC than LC in response to solar UVR. P exposure led to faster recovery of phi PSII, both under HC and LC, than PA and PAB exposure. It appeared that harmful effects of UVR on C. curvisetus could be counteracted by ocean acidification simulated by high CO2 when the effect of climate change is not beyond the tolerance of cells.
Resumo:
Polyclonal antibodies were produced and purified that selectively react with a p53 epitope containing the murine phosphoserine-389 or the human phosphoserine-392 residue, but not the unphosphorylated epitope. These antibodies, termed alpha-392, were employed to demonstrate that the phosphorylation of this serine-389 residue in the p53 protein occurs in vivo in response to ultraviolet radiation of cells containing the p53 protein. After ultraviolet radiation of cells in culture, p53 levels increase and concomitantly serine-389 is phosphorylated in these cells. By contrast, the serine-389 phosphorylation of the p53 protein was not detected by these antibodies in the increased levels of p53 protein made in response to γ radiation or the treatment of cells with etoposide. These results demonstrate an ultraviolet responsive and specific phosphorylation site at serine-389 of the mouse or serine-392 of the human p53 protein. Previous studies have demonstrated that this phosphorylation of p53 activates the protein for specific DNA binding. This study demonstrates in vivo a unique phosphorylation site in the p53 protein that responds to a specific type of DNA damage.
Resumo:
Xeroderma pigmentosum type G (XPG) is a human genetic disease exhibiting extreme sensitivity to sunlight. XPG patients are defective XPG endonuclease, which is an enzyme essential for DNA repair of the major kinds of solar ultraviolet (UV)-induced DNA damages. Here we describe a novel dynamics of this protein within the cell nucleus after UV irradiation of human cells. Using confocal microscopy, we have localized the immunofluorescent, antigenic signal of XPG protein to foci throughout the cell nucleus. Our biochemical studies also established that XPG protein forms a tight association with nuclear structure(s). In human skin fibroblast cells, the number of XPG foci decreased within 2 h after UV irradiation, whereas total nuclear XPG fluorescence intensity remained constant, suggesting redistribution of XPG from a limited number of nuclear foci to the nucleus overall. Within 8 h after UV, most XPG antigenic signal was found as foci. Using beta-galactosidase-XPG fusion constructs (beta-gal-XPG) transfected into HeLa cells, we have identified a single region of XPG that is evidently responsible both for foci formation and for the UV dynamic response. The fusion protein carrying the C terminus of XPG (amino acids 1146-1185) localized beta-gal specific antigenic signal to foci and to the nucleolus regions. After UV irradiation, antigenic beta-gal translocated reversibly from the subnuclear structures to the whole nucleus with kinetics very similar to the movements of XPG protein. These findings lead us to propose a model in which distribution of XPG protein may regulate the rate of DNA repair within transcriptionally active and inactive compartments of the cell nucleus.
Resumo:
A combination of psoralen and ultraviolet A radiation (PUVA) is widely used in the treatment of psoriasis. However, PUVA treatment increases the risk of developing skin cancer in psoriasis patients and induces skin cancer in mice. Since the DNA damage induced by PUVA is quite different from that induced by UV, we investigated whether PUVA-induced mouse skin cancers display carcinogen-specific mutations in the p53 tumor suppressor gene. The results indicated that 10 of 13 (77%) PUVA-induced skin tumors contained missense mutations predominantly at exons 6 and 7. In contrast, tumor-adjacent, PUVA-exposed skin from tumor-bearing animals did not exhibit p53 mutation in exons 4-8. Interestingly, about 40% of all mutations in PUVA-induced skin tumors occurred at 5'-TA sites, and an equal number of mutations occurred at one base flanking 5'TA or 5'-TAT sites. Since PUVA induces DNA cross-links exclusively at these sites and since UV "signature" mutations were rarely detected in PUVA-induced skin cancers, we can conclude that PUVA acts as a carcinogen by inducing unique PUVA signature mutations in p53. This finding may have implications for identifying the etiology of skin cancer in psoriasis patients who have undergone PUVA therapy.
Resumo:
We have examined the seed germination in Arabidopsis thaliana of wild type (wt), and phytochrome A (PhyA)- and B (PhyB)-mutants in terms of incubation time and environmental light effects. Seed germination of the wt and PhyA-null mutant (phyA) was photoreversibly regulated by red and far-red lights of 10-1,000 micromol m-2 when incubated in darkness for 1-14 hr, but no germination occurred in PhyB-null mutant (phyB). When wt seeds and the phyB mutant seeds were incubated in darkness for 48 hr, they synthesized PhyA during dark incubation and germinated upon exposure to red light of 1-100 nmol m-2 and far-red light of 0.5-10 micromol m-2, whereas the phyA mutant showed no such response. The results indicate that the seed germination is regulated by PhyA and PhyB but not by other phytochromes, and the effects of PhyA and PhyB are separable in this assay. We determined action spectra separately for PhyA- and PhyB-specific induction of seed germination at Okazaki large spectrograph. Action spectra for the PhyA response show that monochromatic 300-780 nm lights of very low fluence induced the germination, and this induction was not photoreversible in the range examined. Action spectra for the PhyB response show that germination was photoreversibly regulated by alternate irradiations with light of 0.01-1 mmol m-2 at wavelengths of 540-690 nm and 695-780 nm. The present work clearly demonstrated that PhyA photoirreversibly triggers the germination upon irradiations with ultraviolet, visible and far-red light of very low fluence, while PhyB controls the photoreversible effects of low fluence.
Resumo:
The role of orbital differentiation on the emergence of superconductivity in the Fe-based superconductors remains an open question to the scientific community. In this investigation, we employ a suitable microscopic spin probe technique, namely Electron Spin Resonance (ESR), to investigate this issue on selected chemically substituted BaFe2As2 single crystals. As the spin-density wave (SDW) phase is suppressed, we observe a clear increase of the Fe 3d bands anisotropy along with their localization at the FeAs plane. Such an increase of the planar orbital content is interestingly independent of the chemical substitution responsible for suppressing the SDW phase. As a consequence, the magnetic fluctuations in combination with this particular symmetry of the Fe 3d bands are propitious ingredients for the emergence of superconductivity in this class of materials.
Resumo:
Health economic evaluations require estimates of expected survival from patients receiving different interventions, often over a lifetime. However, data on the patients of interest are typically only available for a much shorter follow-up time, from randomised trials or cohorts. Previous work showed how to use general population mortality to improve extrapolations of the short-term data, assuming a constant additive or multiplicative effect on the hazards for all-cause mortality for study patients relative to the general population. A more plausible assumption may be a constant effect on the hazard for the specific cause of death targeted by the treatments. To address this problem, we use independent parametric survival models for cause-specific mortality among the general population. Because causes of death are unobserved for the patients of interest, a polyhazard model is used to express their all-cause mortality as a sum of latent cause-specific hazards. Assuming proportional cause-specific hazards between the general and study populations then allows us to extrapolate mortality of the patients of interest to the long term. A Bayesian framework is used to jointly model all sources of data. By simulation, we show that ignoring cause-specific hazards leads to biased estimates of mean survival when the proportion of deaths due to the cause of interest changes through time. The methods are applied to an evaluation of implantable cardioverter defibrillators for the prevention of sudden cardiac death among patients with cardiac arrhythmia. After accounting for cause-specific mortality, substantial differences are seen in estimates of life years gained from implantable cardioverter defibrillators.
Resumo:
The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).
Resumo:
Solar radiation, especially ultraviolet A (UVA) and ultraviolet B (UVB), can cause damage to the human body, and exposure to the radiation may vary according to the geographical location, time of year and other factors. The effects of UVA and UVB radiation on organisms range from erythema formation, through tanning and reduced synthesis of macromolecules such as collagen and elastin, to carcinogenic DNA mutations. Some studies suggest that, in addition to the radiation emitted by the sun, artificial sources of radiation, such as commercial lamps, can also generate small amounts of UVA and UVB radiation. Depending on the source intensity and on the distance from the source, this radiation can be harmful to photosensitive individuals. In healthy subjects, the evidence on the danger of this radiation is still far from conclusive.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Nocardia is a rare opportunistic agent, which may affect immunocompromised individuals causing lung infections and exceptionally infective endocarditis (IE). There are few reports of IE caused by Nocardia sp., usually involving biological prostheses but rarely in natural valves. Its accurate microbiological identification may be hampered by the similarity with Rhodococcus equi and Corynebacterium spp. Here we report a case of native mitral valve IE caused by this agent in which the clinical absence of response to vancomycin and the suggestion of Nocardia sp. by histology pointed to the misdiagnosis of Corynebacterium spp. in blood cultures. The histological morphology can advise on the need for expansion of cultivation time and use of extra microbiological procedures that lead to the differential diagnosis with Corynebacterium spp. and other agents, which is essential to establish timely specific treatment, especially in immunocompromised patients.
Resumo:
The aim of the present study was to evaluate the effect of soil characteristics (pH, macro- and micro-nutrients), environmental factors (temperature, humidity, period of the year and time of day of collection) and meteorological conditions (rain, sun, cloud and cloud/rain) on the flavonoid content of leaves of Passiflora incarnata L., Passifloraceae. The total flavonoid contents of leaf samples harvested from plants cultivated or collected under different conditions were quantified by high-performance liquid chromatography with ultraviolet detection (HPLC-UV/PAD). Chemometric treatment of the data by principal component (PCA) and hierarchic cluster analyses (HCA) showed that the samples did not present a specific classification in relation to the environmental and soil variables studied, and that the environmental variables were not significant in describing the data set. However, the levels of the elements Fe, B and Cu present in the soil showed an inverse correlation with the total flavonoid contents of the leaves of P. incarnata.