998 resultados para Specific conductance
Resumo:
An expression-cloning strategy was used to isolate a cDNA that encodes a protein that confers calcitonin gene-related peptide (CGRP) responsiveness to Xenopus laevis oocytes. A guinea pig organ of Corti (the mammalian hearing organ) cDNA library was screened by using an assay based on the cystic fibrosis transmembrane conductance regulator (CFTR). The CFTR is a chloride channel that is activated upon phosphorylation; this channel activity was used as a sensor for CGRP-induced activation of intracellular kinases. A cDNA library from guinea pig organ of Corti was screened by using this oocyte-CFTR assay. A cDNA was identified that contained an open reading frame coding for a small hydrophilic protein that is presumed to be either a CGRP receptor or a component of a CGRP receptor complex. This CGRP receptor component protein confers CGRP-specific activation to the CFTR assay, as no activation was detected upon application of calcitonin, amylin, neuropeptide Y, vasoactive intestinal peptide, or beta-endorphin. In situ hybridization demonstrated that the CGRP receptor component protein is expressed in outer hair cells of the organ of Corti and is colocalized with CGRP-containing efferent nerve terminals.
Resumo:
Specific mutations in the cystic fibrosis transmembrane conductance regulator (CFTR), the most common autosomal recessive fatal genetic disease of Caucasians, result in the loss of epithelial cell adenosine 3',5'-cyclic-monophosphate (cAMP)-stimulated Cl- conductance. We show that the influx of a fluorescent dye, dihydrorhodamine 6G (dR6G), is increased in cells expressing human CFTR after retrovirus- and adenovirus-mediated gene transfer. dR6G influx is stimulated by cAMP and is inhibited by antagonists of cAMP action. Dye uptake is ATP-dependent and inhibited by Cl- removal or the addition of 10 mM SCN-. Increased staining is associated with functional activation of CFTR Cl- permeability. dR6G staining enables both the fluorescent assessment of CFTR function and the identification of successfully corrected cells after gene therapy.
Resumo:
The cystic fibrosis transmembrane conductance regulator (CFTR) functions as a Cl- channel that becomes activated after phosphorylation by cAMP-dependent protein kinase (PKA). We demonstrate that PKA also plays a crucial role in maintaining basal expression of the CFTR gene in the human colon carcinoma cell line T84. Inhibition of PKA activity by expression of a dominant-negative regulatory subunit or treatment with the PKA-selective inhibitor N-[2-(p-bromocinnamylamino)ethyl]-5-isoquinolinesulfonamide (H-89) caused a complete suppression of CFTR gene expression without affecting other constitutively active genes. Basal expression of a 2.2-kb region of the CFTR promoter linked to a luciferase reporter gene (CFTR-luc) exhibited the same dependence on PKA. The ability of cAMP to induce CFTR over basal levels is cell-type specific. In T84 cells, both the endogenous CFTR gene and CFTR-luc exhibited only a modest inducibility (approximately 2-fold), whereas in the human choriocarcinoma cell line JEG-3, CFTR-luc could be induced at least 4-fold. A variant cAMP-response element is present at position -48 to -41 in the CFTR promoter, and mutation of this sequence blocks basal expression. We conclude that cAMP, acting through PKA, is an essential regulator of basal CFTR gene expression and may mediate an induction of CFTR in responsive cell types.
Resumo:
We have cloned two inwardly rectifying K+ channels that occur selectively in neurons in the brain and are designated BIRK (brain inwardly rectifying K+) channels. BIRK1 mRNA is extremely abundant and is enriched in specific brainstem nuclei, BIRK1 displays a consensus phosphate-binding loop, and expression in Xenopus oocytes has shown that its conductance is inhibited by ATP and adenosine 5'-[gamma-thio]triphosphate. BIRK2 is far less abundant and is selectively localized in telencephalic neurons. BIRK2 has a consensus sequence for cAMP-dependent phosphorylation.
Resumo:
Tertiapin, a short peptide from honey bee venom, has been reported to specifically block the inwardly rectifying K+ (Kir) channels, including G protein-coupled inwardly rectifying potassium channel (GIRK) 1 + GIRK4 heteromultimers and ROMK1 homomultimers. In the present study, the effects of a stable and functionally similar derivative of tertiapin, tertiapin-Q, were examined on recombinant human voltage-dependent Ca2+-activated large conductance K+ channel (BK or MaxiK; alpha-subunit or hSlo1 homomultimers) and mouse inwardly rectifying GIRK1 + GIRK2 (i.e., Kir3.1 and Kir3.2) heteromultimeric K+ channels expressed in Xenopus oocytes and in cultured newborn mouse dorsal root ganglion (DRG) neurons. In two-electrode voltage-clamped oocytes, tertiapin-Q (1-100 nM) inhibited BK-type K+ channels in a use- and concentration-dependent manner. We also confirmed the inhibition of recombinant GIRK1 + GIRK2 heteromultimers by tertiapin-Q, which had no effect on endogenous depolarization- and hyperpolarization-activated currents sensitive to extracellular divalent cations (Ca2+, Mg2+, Zn2+, and Ba2+) in defolliculated oocytes. In voltage-clamped DRG neurons, tertiapin-Q voltage- and use-dependently inhibited outwardly rectifying K+ currents, but Cs+-blocked hyperpolarization-activated inward currents including I-H were insensitive to tertiapin-Q, baclofen, barium, and zinc, suggesting absence of functional GIRK channels in the newborn. Under current-clamp conditions, tertiapin-Q blocked the action potential after hyperpolarization (AHP) and increased action potential duration in DRG neurons. Taken together, these results demonstrate that the blocking actions of tertiapin-Q are not specific to Kir channels and that the blockade of recombinant BK channels and native neuronal AHP currents is use-dependent. Inhibition of specific types of Kir and voltage-dependent Ca2+-activated K+ channels by tertiapin-Q at nanomolar range via different mechanisms may have implications in pain physiology and therapy.
Resumo:
The role of orbital differentiation on the emergence of superconductivity in the Fe-based superconductors remains an open question to the scientific community. In this investigation, we employ a suitable microscopic spin probe technique, namely Electron Spin Resonance (ESR), to investigate this issue on selected chemically substituted BaFe2As2 single crystals. As the spin-density wave (SDW) phase is suppressed, we observe a clear increase of the Fe 3d bands anisotropy along with their localization at the FeAs plane. Such an increase of the planar orbital content is interestingly independent of the chemical substitution responsible for suppressing the SDW phase. As a consequence, the magnetic fluctuations in combination with this particular symmetry of the Fe 3d bands are propitious ingredients for the emergence of superconductivity in this class of materials.
Resumo:
Health economic evaluations require estimates of expected survival from patients receiving different interventions, often over a lifetime. However, data on the patients of interest are typically only available for a much shorter follow-up time, from randomised trials or cohorts. Previous work showed how to use general population mortality to improve extrapolations of the short-term data, assuming a constant additive or multiplicative effect on the hazards for all-cause mortality for study patients relative to the general population. A more plausible assumption may be a constant effect on the hazard for the specific cause of death targeted by the treatments. To address this problem, we use independent parametric survival models for cause-specific mortality among the general population. Because causes of death are unobserved for the patients of interest, a polyhazard model is used to express their all-cause mortality as a sum of latent cause-specific hazards. Assuming proportional cause-specific hazards between the general and study populations then allows us to extrapolate mortality of the patients of interest to the long term. A Bayesian framework is used to jointly model all sources of data. By simulation, we show that ignoring cause-specific hazards leads to biased estimates of mean survival when the proportion of deaths due to the cause of interest changes through time. The methods are applied to an evaluation of implantable cardioverter defibrillators for the prevention of sudden cardiac death among patients with cardiac arrhythmia. After accounting for cause-specific mortality, substantial differences are seen in estimates of life years gained from implantable cardioverter defibrillators.
Resumo:
The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Nocardia is a rare opportunistic agent, which may affect immunocompromised individuals causing lung infections and exceptionally infective endocarditis (IE). There are few reports of IE caused by Nocardia sp., usually involving biological prostheses but rarely in natural valves. Its accurate microbiological identification may be hampered by the similarity with Rhodococcus equi and Corynebacterium spp. Here we report a case of native mitral valve IE caused by this agent in which the clinical absence of response to vancomycin and the suggestion of Nocardia sp. by histology pointed to the misdiagnosis of Corynebacterium spp. in blood cultures. The histological morphology can advise on the need for expansion of cultivation time and use of extra microbiological procedures that lead to the differential diagnosis with Corynebacterium spp. and other agents, which is essential to establish timely specific treatment, especially in immunocompromised patients.
Resumo:
With a view toward investigating the feeding behavior of Culicidae mosquitoes from an area of epizootic yellow fever transmission in the municipalities of Garruchos and Santo Antônio das Missões, Rio Grande do Sul State, Brazil, specimens were collected by aspiration from September 2005 to April 2007. The engorged females were submitted to blood meal identification by enzyme-linked immunosorbent assay (ELISA). A total of 142 blood-engorged samples were examined for human or monkey blood through species-specific IgG. Additional tests for specificity utilizing isotypes IgG1 and IgG4 of human monoclonal antibodies showed that only anti-human IgG1 was effective in recognizing blood meals of human origin. The results indicated a significant difference (p = 0.027) in detection patterns in samples of Haemagogus leucocelaenus recorded from human blood meals at Santo Antônio das Missões, which suggests some degree of exposure, since it was an area where epizootic outbreaks have been reported.
Resumo:
Feline Immunodeficiency Virus is a worldwide infection and is considered a significant pathogen. The diagnosis of FIV infections is mainly based on commercially available rapid tests that are highly expensive in Brazil, hence it is rarely performed in the country. Furthermore, lentiviruses grow slowly and poorly in tissue cultures, making the production of viral antigen by classic means and thus the establishment of FIV immunodiagnosis impracticable. In order to deal with this, recombinant DNA techniques were adopted to produce the protein p24, a viral capsid antigen. The protein's reactivity evaluation analyzed by Western blot indicated that this recombinant antigen can be a useful tool for the immunodiagnostic of FIV infections.
Resumo:
While a queen control pheromone complex that inhibits worker ovary development has been described for honey bees, no comparable control pheromones have been identified for their sister group, the stingless bees. The aim of the present work was to search for possible control pheromones in the stingless bee Friesella schrottkyi. No volatile substances were found in the heads of queens that might serve as queen control pheromones. On the other hand, distinct differences were found between the cuticular substances of queens and workers. The major hydrocarbons were different between the two castes, and while queens contained methyl-branched alkanes and no unsaturated hydrocarbons, workers contained alkenes and alka-dienes but no methyl branched hydrocarbons. Colonies deprived of a queen produced laying workers. Differences were observed in the cuticular patterns of laying workers and workers from a queen controlled colony.
Resumo:
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) plays an important role in the life cycle of the Trypanosoma cruzi, and an immobilized enzyme reactor (IMER) has been developed for use in the on-line screening for GAPDH inhibitors. An IMER containing human GAPDH has been previously reported; however, these conditions produced a T. cruzi GAPDH-IMER with poor activity and stability. The factors affecting the stability of the human and T. cruzi GAPDHs in the immobilization process and the influence of pH and buffer type on the stability and activity of the IMERs have been investigated. The resulting T. cruzi GAPDH-IMER was coupled to an analytical octyl column, which was used to achieve chromatographic separation of NAD+ from NADH. The production of NADH stimulated by D-glyceraldehyde-3-phosphate was used to investigate the activity and kinetic parameters of the immobilized T. cruzi GAPDH. The Michaelis-Menten constant (K-m) values determined for D-glyceraldehyde-3-phosphate and NAD(+) were K-m = 0.5 +/- 0.05 mM and 0.648 +/- 0.08 mM, respectively, which were consistent with the values obtained using the non-immobilized enzyme.
Resumo:
Background: Prostate cancer cells in primary tumors have been typed CD10(-)/CD13(-)/CD24(hi)/CD26(+)/CD38(lo)/CD44(-)/CD104(-). This CD phenotype suggests a lineage relationship between cancer cells and luminal cells. The Gleason grade of tumors is a descriptive of tumor glandular differentiation. Higher Gleason scores are associated with treatment failure. Methods: CD26(+) cancer cells were isolated from Gleason 3+3 (G3) and Gleason 4+4 (G4) tumors by cell sorting, and their gene expression or transcriptome was determined by Affymetrix DNA array analysis. Dataset analysis was used to determine gene expression similarities and differences between G3 and G4 as well as to prostate cancer cell lines and histologically normal prostate luminal cells. Results: The G3 and G4 transcriptomes were compared to those of prostatic cell types of non-cancer, which included luminal, basal, stromal fibromuscular, and endothelial. A principal components analysis of the various transcriptome datasets indicated a closer relationship between luminal and G3 than luminal and G4. Dataset comparison also showed that the cancer transcriptomes differed substantially from those of prostate cancer cell lines. Conclusions: Genes differentially expressed in cancer are potential biomarkers for cancer detection, and those differentially expressed between G3 and G4 are potential biomarkers for disease stratification given that G4 cancer is associated with poor outcomes. Differentially expressed genes likely contribute to the prostate cancer phenotype and constitute the signatures of these particular cancer cell types.