1000 resultados para Scale-insects
Resumo:
Aim. To predict the fate of alpine interactions involving specialized species, using a monophagous beetle and its host-plant as a case study. Location. The Alps. Methods. We investigated genetic structuring of the herbivorous beetle Oreina gloriosa and its specific host-plant Peucedanum ostruthium. We used genome fingerprinting (in the insect and the plant) and sequence data (in the insect) to compare the distribution of the main gene pools in the two associated species and to estimate divergence time in the insect, a proxy for the temporal origin of the interaction. We quantified the similarity in spatial genetic structures by performing a Procrustes analysis, a tool from the shape theory. Finally, we simulated recolonization of an empty space analogous to the deglaciated Alps just after ice retreat by two lineages from two species showing unbalanced dependence, to examine how timing of the recolonization process, as well as dispersal capacities of associated species, could explain the observed pattern. Results. Contrasting with expectations based on their asymmetrical dependence, patterns in the beetle and plant were congruent at a large scale. Exceptions occurred at a regional scale in areas of admixture, matching known suture zones in Alpine plants. Simulations using a lattice-based model suggested these empirical patterns arose during or soon after recolonization, long after the estimated origin of the interaction c. 0.5 million years ago. Main conclusions. Species-specific interactions are scarce in alpine habitats because glacial cycles have limited opportunities for coevolution. Their fate, however, remains uncertain under climate change. Here we show that whereas most dispersal routes are paralleled at large scale, regional incongruence implies that the destinies of the species might differ under changing climate. This may be a consequence of the host-dependence of the beetle that locally limits the establishment of dispersing insects.
Resumo:
Small-scale village woodlots of less than 0.5ha are the preferred use of land for local farmers with extra land in the village of Isangati, a small community located in the southern highlands of Tanzania. Farmers view woodlots as lucrative investments that do not involve intensive labor or time. The climate is ideal for the types of trees grown and the risks are minimal with no serious threats from insects, fires, thieves, or grazing livestock. It was hypothesized that small-scale village woodlot owners were not maximizing timber outputs with their current timber stand management and harvesting techniques. Personal interviews were conducted over a five month period and field data was collected at each farmer’s woodlots over a seven month period. Woodlot field data included woodlot size, number of trees, tree species, tree height, dbh, age, and spacing. The results indicated that the lack of proper woodlot management techniques results in failure to fully capitalize on the investment of woodlots. While farmers should continue with their current harvesting rotations, some of the reasons for not maximizing tree growth include close spacing (2m x 2m), no tree thinning, extreme pruning (60% of tree), and little to no weeding. Through education and hands-on woodlot management workshops, the farmers could increase their timber output and value of woodlots.
Resumo:
Trypsins and chymotrypsins are well-studied serine peptidases that cleave peptide bonds at the carboxyl side of basic and hydrophobic l-amino acids, respectively. These enzymes are largely responsible for the digestion of proteins. Three primary processes regulate the activity of these peptidases: secretion, precursor (zymogen) activation and substrate-binding site recognition. Here, we present a detailed phylogenetic analysis of trypsins and chymotrypsins in three orders of holometabolous insects and reveal divergent characteristics of Lepidoptera enzymes in comparison with those of Coleoptera and Diptera. In particular, trypsin subsite S1 was more hydrophilic in Lepidoptera than in Coleoptera and Diptera, whereas subsites S2-S4 were more hydrophobic, suggesting different substrate preferences. Furthermore, Lepidoptera displayed a lineage-specific trypsin group belonging only to the Noctuidae family. Evidence for facilitated trypsin auto-activation events were also observed in all the insect orders studied, with the characteristic zymogen activation motif complementary to the trypsin active site. In contrast, insect chymotrypsins did not seem to have a peculiar evolutionary history with respect to their mammal counterparts. Overall, our findings suggest that the need for fast digestion allowed holometabolous insects to evolve divergent groups of peptidases with high auto-activation rates, and highlight that the evolution of trypsins led to a most diverse group of enzymes in Lepidoptera.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
The aim of this study was to translate, validate and verify the reliability of the Body Area Scale (BAS). Participants were 386 teenagers, enrolled in a private school. Translation into Portuguese was conducted. The instrument was evaluated for internal consistency and construct validation analysis. Reproducibility was evaluated using the Wilcoxon test and the coefficient of interclass correlation. The BAS demonstrated good values for internal consistency (0.90 and 0.88) and was able to discriminate boys and girls according to nutritional state (p = 0.020 and p = 0.026, respectively). BAS scores correlated with adolescents' BMI (r = 0.14, p = 0.055; r = 0.23, p = 0.001) and WC (r =0.13, p = 0.083; r = 0.22, 0.002). Reliability was confirmed by the coefficient of inter-class correlation (0.35, p < 0.001; 0.60, p < 0.001) for boys and girls, respectively. The instrument performed well in terms of understanding and time of completion. BAS was successfully translated into Portuguese and presented good validity when applied to adolescents.
Resumo:
Eating attitudes are defined as beliefs, thoughts, feelings, behaviors and relationship with food. They could influence people’s food choices and their health status. Objective: This study aimed to adapt from Portuguese to English the Disordered Eating Attitude Scale (DEAS) and evaluate its validity and reliability. The original scale in Portuguese was translated and adapted into English and was applied to female university students of University of Minnesota—USA (n = 224). Internal consistency was determined (Cronbach’s Alpha). Convergent validity was assessed by correlations between Eating Attitude Test-26 (EAT-26) and Restrain Scale (RS). Reliability was evaluated applying twice the scale to a sub-sample (n = 30). The scale was back translated into Portuguese and compared with the original version and discrepancies were not found. The internal consistency was .76. The DEAS total score was significantly associated with EAT-26 (r = 0.65) and RS (r = 0.69) scores. The correlation between test–retest was r = 0.9. The English version of DEAS showed appropriate internal consistency, convergent validity and test–retest reliability and will be useful to assess eating attitudes in different population groups in English spoken countries
Resumo:
Using differential x-ray absorption spectroscopy (DiffXAS) we have measured and quantified the intrinsic, atomic-scale magnetostriction of Fe(81)Ga(19). By exploiting the chemical selectivity of DiffXAS, the Fe and Ga local environments have been assessed individually. The enhanced magnetostriction induced by the addition of Ga to Fe was found to originate from the Ga environment, where lambda(gamma,2)(approximate to (3/2)lambda(100)) is 390 +/- 40 ppm. In this environment, < 001 > Ga-Ga pair defects were found to exist, which mediate the magnetostriction by inducing large strains in the surrounding Ga-Fe bonds. For the first time, intrinsic, chemically selective magnetostrictive strain has been measured and quantified at the atomic level, allowing true comparison with theory.
Resumo:
In Brazil, the study of pedestrian-induced vibration on footbridges has been undertaken since the early 1990s, for concrete and steel footbridges. However, there are no recorded studies of this kind for timber footbridges. Brazilian code ABNT NBR 7190 (1997) gives design requirements only for static loads in the case of timber footbridges, without considering the serviceability limit state from pedestrian-induced vibrations. The aim of this work is to perform a theoretical dynamic, numerical and experimental analysis on simply-supported timber footbridges, by using a small-scale model developed from a 24 m span and 2 m width timber footbridge, with two main timber beams. Span and width were scaled down (1:4) to 6 m e 0.5 in, respectively. Among the conclusions reached herein, it is emphasized that the Euler-Bernoulli beam theory is suitable for calculating the vertical and lateral first natural frequencies in simply-supported timber footbridges; however, special attention should be given to the evaluation of lateral bending stiffness, as it leads to conservative values.
Resumo:
Carrying out information about the microstructure and stress behaviour of ferromagnetic steels, magnetic Barkhausen noise (MBN) has been used as a basis for effective non-destructive testing methods, opening new areas in industrial applications. One of the factors that determines the quality and reliability of the MBN analysis is the way information is extracted from the signal. Commonly, simple scalar parameters are used to characterize the information content, such as amplitude maxima and signal root mean square. This paper presents a new approach based on the time-frequency analysis. The experimental test case relates the use of MBN signals to characterize hardness gradients in a AISI4140 steel. To that purpose different time-frequency (TFR) and time-scale (TSR) representations such as the spectrogram, the Wigner-Ville distribution, the Capongram, the ARgram obtained from an AutoRegressive model, the scalogram, and the Mellingram obtained from a Mellin transform are assessed. It is shown that, due to nonstationary characteristics of the MBN, TFRs can provide a rich and new panorama of these signals. Extraction techniques of some time-frequency parameters are used to allow a diagnostic process. Comparison with results obtained by the classical method highlights the improvement on the diagnosis provided by the method proposed.
Resumo:
A susceptible-infective-recovered (SIR) epidemiological model based on probabilistic cellular automaton (PCA) is employed for simulating the temporal evolution of the registered cases of chickenpox in Arizona, USA, between 1994 and 2004. At each time step, every individual is in one of the states S, I, or R. The parameters of this model are the probabilities of each individual (each cell forming the PCA lattice ) passing from a state to another state. Here, the values of these probabilities are identified by using a genetic algorithm. If nonrealistic values are allowed to the parameters, the predictions present better agreement with the historical series than if they are forced to present realistic values. A discussion about how the size of the PCA lattice affects the quality of the model predictions is presented. Copyright (C) 2009 L. H. A. Monteiro et al.
Resumo:
Introduction. This protocol aims at preparing total RNA for gene expression analysis by Northern blots, RT-PCR and real-time quantitative PCR; cDNA isolation by RTPCR; and cDNA library construction. The principle, key advantages, starting plant material, time required for obtaining total RNA and expected results are presented. Materials and methods. This part describes the required materials and the 27 steps necessary for preparing RNA from peel and pulp fruit tissue: preparation of plant tissue powder, preparation of the complete RNA extraction buffer and isolation of RNA from ground banana fruit tissue. Results. Extraction of total RNA by the method described makes it possible to achieve electrophoresis under denatured conditions and in vitro reverse transcription. An example for Northern blot analysis is illustrated.