916 resultados para NEUTRON DIFFRACTION


Relevância:

100.00% 100.00%

Publicador:

Resumo:

A magnetic difference neutron diffraction study of a rare-earth (Tb) phosphate glass has revealed exclusively the Tb...Tb distances. The difference between data taken with and without an applied magnetic field of 4 T shows Tb...Tb pairwise atomic correlations at 3.9 and 6.4 A, respectively, with relative coordination numbers of 1:14. The first distance arises when two Tb3+ ions share a common oxygen neighbor, and indicates a clustering of rare-earth ions. The second distance arises when two Tb3+ ions are coordinated to different oxygens in the same PO4 group, in a near-linear arrangement.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Neutron diffraction was used to measure the structure of the phosphate glasses RAl0.30P3.05O9.62, where R denotes Dy or Ho, and RAl0.34P3.20O10.04, where R denotes La or Ce. For each glass, isomorphic structures were assumed and difference function methods were employed to separate, essentially, those correlations involving the rare-earth ion, R3+, from the remainder. The ratio of bridging oxygen, OB, to terminal oxygen, OT, atoms in the PO4 tetrahedra was quantified and in both materials R3+ and Al3+ are found to act as network modifying cations which bind to the OT. The R–OT coordination number is 6.7(1) and 7.5(2) for the Dy/Ho and La/Ce glasses respectively.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The relative distribution of rare-earth ions R3+ (Dy3+ or Ho3+) in the phosphate glass RAl0.30P3.05O9.62 was measured by employing the method of isomorphic substitution in neutron diffraction and, by taking the role of Al into explicit account, a self-consistent model of the glass structure was developed. The glass network is found to be made from corner sharing PO4 tetrahedra in which there are, on average, 2.32(9) terminal oxygen atoms, OT, at 1.50(1) Å and 1.68(9) bridging oxygen atoms, OB, at 1.60(1) Å. The network modifying R3+ ions bind to an average of 6.7(1) OT and are distributed such that 7.9(7) R–R nearest neighbours reside at 5.62(6) Å. The Al3+ ion also has a network modifying role in which it helps to strengthen the glass through the formation of OT–Al–OT linkages. The connectivity of the R-centred coordination polyhedra in (M2O3)x(P2O5)1−x glasses, where M3+ denotes a network modifying cation (R3+ or Al3+), is quantified in terms of a parameter fs. Methods for reducing the clustering of rare-earth ions in these materials are then discussed, based on a reduction of fs via the replacement of R3+ by Al3+ at fixed total modifier content or via a change of x to increase the number of OT available per network modifying M3+ cation.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Neutron diffraction was used to measure the total structure factors for several rare-earth ion R3+ (La3+ or Ce3+) phosphate glasses with composition close to RAl0.35P3.24O10.12. By assuming isomorphic structures, difference function methods were employed to separate, essentially, those correlations involving R3+ from the remainder. A self-consistent model of the glass structure was thereby developed in which the Al correlations were taken into explicit account. The glass network was found to be made from interlinked PO4 tetrahedra having 2.2(1) terminal oxygen atoms, OT, at 1.51(1) Angstrom, and 1.8(1) bridging oxygen atoms, OB, at 1.60(1) Angstrom. Rare-earth cations bonded to an average of 7.5(2) OT nearest neighbors in a broad and asymmetric distribution. The Al3+ ion acted as a network modifier and formed OT-A1-OT linkages that helped strengthen the glass. The connectivity of the R-centered coordination polyhedra was quantified in terms of a parameter f(s) and used to develop a model for the dependence on composition of the A1-OT coordination number in R-A1-P-O glasses. By using recent 17 A1 nuclear-magnetic-resonance data, it was shown that this connectivity decreases monotonically with increasing Al content. The chemical durability of the glasses appeared to be at a maximum when the connectivity of the R-centered coordination polyhedra was at a minimum. The relation of f(s) to the glass transition temperature, Tg, was discussed.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The total structure factor of molten TbCl3 at 617ºC was measured by using neutron diffraction. The data are in agreement with results from previous experimental work but the use of a diffractometer having an extended reciprocal-space measurement window leads to improved resolution in real space. Significant discrepancies with the results obtained from recent molecular dynamics simulations carried out using a polarizable ion model, in which the interaction potentials were optimized to enhance agreement with previous diffraction data, are thereby highlighted. It is hence shown that there is considerable scope for the development of this model for TbCl3 and for other trivalent metal halide systems spanning a wide range of ion size ratios.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Real-time small angle neutron scattering and wide angle neutron scattering studies were undertaken concurrently on a glass ionomer of nominal composition 4.5(SiO2)-3(Al2O3)-1.5(P2O5)-3(CaO)-2(CaF2). Neutron studies were conducted as a function of temperature to investigate the crystallisation process. No amorphous phase separation was observed at room temperature and the onset of crystallisation was found to occur at 650°C, which is 90°C lower than previously reported. The first crystalline phase observed corresponded to fluorapatite; it was only upon further heating was the mullite phase became present. The crystallite size at 650°C was found to be ~115Å and the result was consistent across all measurements.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Total neutron scattering has been used to follow the hydrogenation of toluene-d8 to methylcyclohexane-d14 over 3 wt% platinum supported on highly ordered mesoporous silica (MCM-41) at 298 K and under 150 mbar D2 pressure. The detailed kinetic information so revealed indicates that liquid reorganisation inside pores is the slowest step of the whole process. Additionally, the results were compared with the reaction performed under 250 mbar D2 pressure as well as with toluene-h8 hydrogenation using D2 at 150 mbar.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

The magnetic structures and the magnetic phase transitions in the Mn-doped orthoferrite TbFeO3 studied using neutron powder diffraction are reported. Magnetic phase transitions are identified at T-N(Fe/Mn) approximate to 295K where a paramagnetic-to-antiferromagnetic transition occurs in the Fe/Mn sublattice, T-SR(Fe/Mn) approximate to 26K where a spin-reorientation transition occurs in the Fe/Mn sublattice and T-N(R) approximate to 2K where Tb-ordering starts to manifest. At 295 K, the magnetic structure of the Fe/Mn sublattice in TbFe0.5Mn0.5O3 belongs to the irreducible representation Gamma(4) (G(x)A(y)F(z) or Pb'n'm). A mixed-domain structure of (Gamma(1) + Gamma(4)) is found at 250K which remains stable down to the spin re-orientation transition at T-SR(Fe/Mn) approximate to 26K. Below 26K and above 250 K, the majority phase (>80%) is that of Gamma(4). Below 10K the high-temperature phase Gamma(4) remains stable till 2K. At 2 K, Tb develops a magnetic moment value of 0.6(2) mu(B)/f.u. and orders long-range in F-z compatible with the Gamma(4) representation. Our study confirms the magnetic phase transitions reported already in a single crystal of TbFe0.5Mn0.5O3 and, in addition, reveals the presence of mixed magnetic domains. The ratio of these magnetic domains as a function of temperature is estimated from Rietveld refinement of neutron diffraction data. Indications of short-range magnetic correlations are present in the low-Q region of the neutron diffraction patterns at T < T-SR(Fe/Mn). These results should motivate further experimental work devoted to measure electric polarization and magnetocapacitance of TbFe0.5Mn0.5O3. (C) 2016 AIP Publishing LLC.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

The magnetic structures and the magnetic phase transitions in the Mn-doped orthoferrite TbFeO3 studied using neutron powder diffraction are reported. Magnetic phase transitions are identified at T-N(Fe/Mn) approximate to 295K where a paramagnetic-to-antiferromagnetic transition occurs in the Fe/Mn sublattice, T-SR(Fe/Mn) approximate to 26K where a spin-reorientation transition occurs in the Fe/Mn sublattice and T-N(R) approximate to 2K where Tb-ordering starts to manifest. At 295 K, the magnetic structure of the Fe/Mn sublattice in TbFe0.5Mn0.5O3 belongs to the irreducible representation Gamma(4) (G(x)A(y)F(z) or Pb'n'm). A mixed-domain structure of (Gamma(1) + Gamma(4)) is found at 250K which remains stable down to the spin re-orientation transition at T-SR(Fe/Mn) approximate to 26K. Below 26K and above 250 K, the majority phase (>80%) is that of Gamma(4). Below 10K the high-temperature phase Gamma(4) remains stable till 2K. At 2 K, Tb develops a magnetic moment value of 0.6(2) mu(B)/f.u. and orders long-range in F-z compatible with the Gamma(4) representation. Our study confirms the magnetic phase transitions reported already in a single crystal of TbFe0.5Mn0.5O3 and, in addition, reveals the presence of mixed magnetic domains. The ratio of these magnetic domains as a function of temperature is estimated from Rietveld refinement of neutron diffraction data. Indications of short-range magnetic correlations are present in the low-Q region of the neutron diffraction patterns at T < T-SR(Fe/Mn). These results should motivate further experimental work devoted to measure electric polarization and magnetocapacitance of TbFe0.5Mn0.5O3. (C) 2016 AIP Publishing LLC.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

The magnetic structures and the magnetic phase transitions in the Mn-doped orthoferrite TbFeO3 studied using neutron powder diffraction are reported. Magnetic phase transitions are identified at T-N(Fe/Mn) approximate to 295K where a paramagnetic-to-antiferromagnetic transition occurs in the Fe/Mn sublattice, T-SR(Fe/Mn) approximate to 26K where a spin-reorientation transition occurs in the Fe/Mn sublattice and T-N(R) approximate to 2K where Tb-ordering starts to manifest. At 295 K, the magnetic structure of the Fe/Mn sublattice in TbFe0.5Mn0.5O3 belongs to the irreducible representation Gamma(4) (G(x)A(y)F(z) or Pb'n'm). A mixed-domain structure of (Gamma(1) + Gamma(4)) is found at 250K which remains stable down to the spin re-orientation transition at T-SR(Fe/Mn) approximate to 26K. Below 26K and above 250 K, the majority phase (>80%) is that of Gamma(4). Below 10K the high-temperature phase Gamma(4) remains stable till 2K. At 2 K, Tb develops a magnetic moment value of 0.6(2) mu(B)/f.u. and orders long-range in F-z compatible with the Gamma(4) representation. Our study confirms the magnetic phase transitions reported already in a single crystal of TbFe0.5Mn0.5O3 and, in addition, reveals the presence of mixed magnetic domains. The ratio of these magnetic domains as a function of temperature is estimated from Rietveld refinement of neutron diffraction data. Indications of short-range magnetic correlations are present in the low-Q region of the neutron diffraction patterns at T < T-SR(Fe/Mn). These results should motivate further experimental work devoted to measure electric polarization and magnetocapacitance of TbFe0.5Mn0.5O3. (C) 2016 AIP Publishing LLC.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

The magnetic structures and the magnetic phase transitions in the Mn-doped orthoferrite TbFeO3 studied using neutron powder diffraction are reported. Magnetic phase transitions are identified at T-N(Fe/Mn) approximate to 295K where a paramagnetic-to-antiferromagnetic transition occurs in the Fe/Mn sublattice, T-SR(Fe/Mn) approximate to 26K where a spin-reorientation transition occurs in the Fe/Mn sublattice and T-N(R) approximate to 2K where Tb-ordering starts to manifest. At 295 K, the magnetic structure of the Fe/Mn sublattice in TbFe0.5Mn0.5O3 belongs to the irreducible representation Gamma(4) (G(x)A(y)F(z) or Pb'n'm). A mixed-domain structure of (Gamma(1) + Gamma(4)) is found at 250K which remains stable down to the spin re-orientation transition at T-SR(Fe/Mn) approximate to 26K. Below 26K and above 250 K, the majority phase (>80%) is that of Gamma(4). Below 10K the high-temperature phase Gamma(4) remains stable till 2K. At 2 K, Tb develops a magnetic moment value of 0.6(2) mu(B)/f.u. and orders long-range in F-z compatible with the Gamma(4) representation. Our study confirms the magnetic phase transitions reported already in a single crystal of TbFe0.5Mn0.5O3 and, in addition, reveals the presence of mixed magnetic domains. The ratio of these magnetic domains as a function of temperature is estimated from Rietveld refinement of neutron diffraction data. Indications of short-range magnetic correlations are present in the low-Q region of the neutron diffraction patterns at T < T-SR(Fe/Mn). These results should motivate further experimental work devoted to measure electric polarization and magnetocapacitance of TbFe0.5Mn0.5O3. (C) 2016 AIP Publishing LLC.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

The compounds chlorothiazide and hydrochlorothiazide (crystalline form II) have been studied in their fully hydrogenous forms by powder neutron diffraction on the GEM diffractometer. The results of joint Rietveld refinement of the structures against multi-bank neutron and single-bank X-ray powder data are reported and show that accurate and precise structural information can be obtained from polycrystalline molecular organic materials by this route.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.