Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Thaptomys Thomas 1915 (Rodentia, Sigmodontinae, Akodontini) with karyotypes 2n = 50, FN = 48, and 2n = 52, FN = 52: two monophyletic lineages recovered by molecular phylogeny

A novel karyotype with 2n = 50, FN = 48, was described for specimens of Thaptomys collected at Una, State of Bahia, Brazil, which are morphologically indistinguishable from Thaptomys nigrita, 2n = 52, FN = 52, found in other localities. It was hence proposed that the 2n = 50 karyotype could belong to a distinct species, cryptic of Thaptomys nigrita, once chromosomal rearrangements observed, along with the geographic distance, might represent a reproductive barrier between both forms. Phylogenetic analyses using maximum parsimony and maximum likelihood based on partial cytochrome b sequences with 1077 bp were performed, attempting to establish the relationships among the individuals with distinct karyotypes along the geographic distribution of the genus; the sample comprised 18 karyotyped specimens of Thaptomys, encompassing 15 haplotypes, from eight different localities of the Atlantic Rainforest. The intra-generic relationships corroborated the distinct diploid numbers, once both phylogenetic reconstructions recovered two monophyletic lineages, a northeastern clade grouping the 2n = 50 and a southeastern clade with three subclades, grouping the 2n = 52 karyotype. The sequence divergence observed between their individuals ranged from 1.9% to 3.5%.

Description of the pupal case of Systropus (Systropus) nitidus Wiedemann, 1830 (Diptera, Bombyliidae, Toxophorinae, Systropodini)

The pupal case of Systropus (Systropus) nitidus Wiedemann reared from an unidentified tipical Limacodidae (Lepidoptera) cocoon is described and illustrated for the first time. Only species of Limacodidae are recorded as host of the immature stages of S. (Systropus). The geographical distribution of S. (Systropus) nitidus is restricted to Brazil, from Pará to Santa Catarina states. This is the first pupal case description and illustration of a Neotropical species of the subgenus Systropus.

Cytogenetic analysis of Astylus antis (Perty, 1830) (Coleoptera, Melyridae): Karyotype, heterochromatin and location of ribosomal genes

Cytogenetic analysis of Astylus antis using mitotic and meiotic cells was performed to characterize the haploid and diploid numbers, sex determination system, chromosome morphology, constitutive heterochromatin distribution pattern and chromosomes carrying nucleolus organizer regions (NORs). Analysis of spermatogonial metaphase cells revealed the diploid number 2n = 18, with mostly metacentric chromosomes. Metaphase I cells exhibited 2n = 8II+Xyp and a parachute configuration of the sex chromosomes. Spermatogonial metaphase cells submitted to C-banding showed the presence of small dots of constitutive heterochromatin in the centromeric regions of nearly all the autosomes and on the short arm of the X chromosome (Xp), as well as an additional band on one of the arms of pair 1. Mitotic cells submitted to double staining with base-specific fluorochromes (DAPI-CMA3) revealed no regions rich in A+T or G+C sequences. Analysis of spermatogonial mitotic cells after sequential Giemsa/AgNO3 staining did not reveal any specific mark on the chromosomes. Meiotic metaphase I cells stained with silver nitrate revealed a strong impregnation associated to the sex chromosomes, and in situ hybridization with an 18S rDNA probe showed ribosomal cistrons in an autosomal bivalent.

The subfamily Aephnidiogeninae Yamaguti, 1934 (Digenea: Lepocreadiidae), its status and that of the genera Aephnidiogenes Nicoll, 1915, Holorchis Stossich, 1901, Austroholorchis n g, Pseudaephnidiogenes Yamaguti, 1971, Pseudoholorchis Yamaguti, 1958 and N

The status of all of the putative member genera of the subfamily Aephnidiogeninae is reconsidered, based mainly on the morphology of the terminal genitalia, Aephnidiogenes Nicoll, 1915 is the only genus retained in the Aaephnidiogeninae. Aephnidiogenes major Yamaguti, 1934 from Diagramma labiosum from the southern Great Barrier Reef is redescribed with particular reference to the terminal genitalia, and is shown to lack a true cirrussac, a condition considered to be diagnostic of the Aephnidiogeninae. Holorchis Stossich, 1901 is placed in the subfamily Lepidapedinae. Holorchis pycnoporus Stossich, 1901 from Pagellus acarne from off Spanish Sahara and from Diplodus vulgaris from off Italy and H. legendrei Dollfus, 1946 from Sparodon durbanensis and D. sargus from off eastern Cape Province, South Africa and from Pagellus erythrinus from the Adriatic Sea and Italy are studied and illustrated. The terminal genitalia of H. pycnoporus are found to be enigmatic, but those of H. legendrei are found to fit clearly into the 'Lepidapedon-like' pattern. A new genus Austroholorchis is erected in the Lepidapedinae, with A. sprenti (Gibson, 1987) n. comb. as the type-species. Its diagnostic features are its ani, infundibuliform oral sucker and the position of the ovary at about mid-level of the uterus. A. sprenti is illustrated, its hosts in Queensland waters being Sillago maculata, S, analis and S. ciliata. A, levis n. sp. is described from Sillago bassensis from south-western Western Australia. The genus Pseudaephnidiogenes Yamaguti, 1971 is placed in the Lepidapedinae. P. rhabdosargi (Prudhoe, 1956) from Rhabdosargus sarba from off Natal, South Africa is illustrated and the terminal genitalia of P. rhabdosargi from R. sarba and from R. holubi from off eastern Cape Province and Pseudaephnidiogenes vossi Bray, 1985 from Caffrogobius nudiceps from off eastern Cape Province, South Africa are illustrated. The genus Pseudoholorchis Yamaguti, 1958 is placed in the subfamily Lepocreadiinae. The terminal genitalia of P. pulcher (Manter, 1954) from Latridopsis ciliaris from New Zealand are illustrated, The genus Neolepocreadium Thomas, 1960 is placed in the Lepocreadiidae.

Viajar é preciso: Theodor Koch-Grünberg e a Völkerkunde alemã do século XIX

Tomando a etnografia de Theodor Koch-Grünberg como realização ideal do projeto científico da Völkerkunde (antropologia) alemã desde a sua invenção por Waitz e, principalmente, Adolf Bastian, até a sua auto-eliminação nos primórdios do Terceiro Reich, analisamos inicialmente as raízes desse projeto na filosofia alemã, desde Herder até a ruptura neokantiana entre as ciências naturais e sociais (ou culturais) na metade do século XIX. Em seguida mostramos que, transformados em programa etnográfico, os pressupostos epistêmicos da Völkerkunde eram, desde o início, condenados ao fracasso, não obstante os heróicos esforços como este de Koch-Grünberg.

Infecção experimental de Calomys callosus (Rengger, 1830), (Cricetidae - Rodentia) a quatro espécies de parasitos

Neste trabalho foram estudados exemplares do roedor, Calomys callosus, nascidos em laboratório, a infecções experimentais com quatro parasitos: Plasmodium berghei, Leishmania mexicana amazonensis, Schistosoma mansoni e Hymenolepsis nana. A positividade das infecções foi de 80% para os três primeiros parasitos e 0 para H. nana. C. callosus é um roedor de excelente adaptação em laboratório e de fácil manuseio. Acredita-se que, de acordo com os resultados obtidos neste trabalho, este animal poderia ser um bom modelo experimental de laboratório para certos agentes patogênicos.

Entrevista ao Professor Theodor Hauschild

Revista do IHA, N.4 (2007), pp.24-27

Observações sobre a ocorrência de Mosca-Negra-dos-Citros, Aleurocanthus woglumi Ashby, 1915 (Hemiptera: Sternorrhyncha: Aleyrodidae) no estado do Amazonas

A mosca-negra-dos-citros (Aleurocanthus woglumi Ashby) é uma importante praga dos citros de origem asiática. Foi detectada no Brasil pela primeira vez em Belém-PA em 2001. Este trabalho tem como objetivo registrar a ocorrência de mosca-negra-dos-citros no estado do Amazonas, sua distribuição geográfica e estudos de biologia em condições de laboratório. A mosca-negra encontra-se atualmente disseminada em mais da metade dos municípios paraenses. No Amazonas foi detectada em junho de 2004 em Manaus e atualmente encontra-se disseminada em toda a área urbana deste município, ocorrendo também em Itacoatiara, Rio Preto da Eva e Iranduba. Em observações feitas em condições de laboratório em Manaus-AM, foi verificado que o ciclo de ovo-adulto foi de 71,76±2,07 dias, caracterizando como uma espécie multivoltina.

Carl Friedrich Forster's Handbuch der Cacteenkunde in ihrem ganzen Umfange :nach dem gegenwartigen Stande der Wissenschaft bearbeitet und durch die seit 1846 begrundetet Gattungen und neu eingefuhrten Arten vermehrt /von Theodor Rumpler.

Bd. 1