Mini-chromosomes derived from the human Y chromosome by telomere directed chromosome breakage.

We have used telomeric DNA to break two acrocentric derivatives of the human Y chromosome into mini-chromosomes that are small enough to be size- fractionated by pulsed-field gel electrophoresis. One of the mini-chromosomes is about 7 Mb in size and sequence-tagged site analysis of this molecule suggests that it corresponds to a simple truncation of the short arm of the Y chromosome. Five of the mini-chromosomes are derived from the long arm, are all rearranged by more than a simple truncation, and range in size from 4.0 Mb to 9 Mb. We have studied the mitotic stabilities of these mini-chromosomes and shown that they are stably maintained by cells proliferating in culture for about 100 cell divisions.

A methylated human 9-kb repetitive sequence on acrocentric chromosomes is homologous to a subtelomeric repeat in chimpanzees.

We have implemented an approach for the detection of DNA alterations in cancer by means of computerized analysis of end-labeled genomic fragments, separated in two dimensions. Analysis of two-dimensional patterns of neuroblastoma tumors, prepared by first digesting DNA with the methylation-sensitive restriction enzyme Not I, yielded a multicopy fragment which was detected in some tumor patterns but not in normal controls. Cloning and sequencing of the fragment, isolated from two-dimensional gels, yielded a sequence with a strong homology to a subtelomeric sequence in chimpanzees and which was previously reported to be undetectable in humans. Fluorescence in situ hybridization indicated the occurrence of this sequence in normal tissue, for the most part in the satellite regions of acrocentric chromosomes. A product containing this sequence was obtained by telomere-anchored PCR using as a primer an oligonucleotide sequence from the cloned fragment. Our data suggest demethylation of cytosines at the cloned Not I site and in neighboring DNA in some tumors, compared with normal tissue, and suggest a greater similarity between human and chimpanzee subtelomeric sequences than was previously reported.

Specific cloning of human DNA as yeast artificial chromosomes by transformation-associated recombination.

DNA molecules undergoing transformation into yeast are highly recombinogenic, even when diverged. We reasoned that transformation-associated recombination (TAR) could be employed to clone large DNAs containing repeat sequences, thereby eliminating the need for in vitro enzymatic reactions such as restriction and ligation and reducing the amount of DNA handling. Gently isolated human DNA was transformed directly into yeast spheroplasts along with two genetically marked (M1 and M2) linearized vectors that contained a human Alu sequence at one end and a telomere sequence at the other end (Alu-CEN-M1-TEL and Alu-M2-TEL). Nearly all the M1-selected transformants had yeast artificial chromosomes (YACs) containing human DNA inserts that varied in size from 70 kb to > 600 kb. Approximately half of these had also acquired the unselected M2 marker. The mitotic segregational stability of YACs generated from one (M1) or two (M1 and M2) vector(s) was comparable, suggesting de novo generation of telomeric ends. Since no YACs were isolated when rodent DNAs or a vector lacking an Alu sequence was used, the YACs were most likely the consequence of TAR between the repeat elements on the vector(s) and the human DNA. Using the BLUR13 Alu-containing vector, we demonstrated that human DNA could be efficiently cloned from mouse cells that contained a single human chromosome 16. The distribution of cloned DNAs on chromosome 16 was determined by fluorescence in situ hybridization. We propose that TAR cloning can provide an efficient means for generating YACs from specific chromosomes and subchromosome fragments and that TAR cloning may be useful for isolating families of genes and specific genes from total genome DNA.

Use of yeast artificial chromosomes (YACs) in studies of mammalian development: production of beta-globin locus YAC mice carrying human globin developmental mutants.

To test whether yeast artificial chromosomes (YACs) can be used in the investigation of mammalian development, we analyzed the phenotypes of transgenic mice carrying two types of beta-globin locus YAC developmental mutants: (i) mice carrying a G-->A transition at position -117 of the A gamma gene, which is responsible for the Greek A gamma form of hereditary persistence of fetal hemoglobin (HPFH), and (ii) beta-globin locus YAC transgenic lines carrying delta- and beta-globin gene deletions with 5' breakpoints similar to those of deletional HPFH and delta beta-thalassemia syndromes. The mice carrying the -117 A gamma G-->A mutation displayed a delayed gamma- to beta-globin gene switch and continued to express A gamma-globin chains in the adult stage of development as expected for carriers of Greek HPFH, indicating that the YAC/transgenic mouse system allows the analysis of the developmental role of cis-acting motifs. The analysis of mice carrying 3' deletions first provided evidence in support of the hypothesis that imported enhancers are responsible for the phenotypes of deletional HPFH and second indicated that autonomous silencing is the primary mechanism for turning off the gamma-globin genes in the adult. Collectively, our results suggest that transgenic mice carrying YAC mutations provide a useful model for the analysis of the control of gene expression during development.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Mutations in CIC and FUBP1 Contribute to Human Oligodendroglioma

Oligodendrogliomas are the second most common malignant brain tumor in adults and exhibit characteristic losses of chromosomes 1p and 19q. To identify the molecular genetic basis for this alteration, we performed exomic sequencing of seven tumors. Among other changes, we found that the CIC gene (homolog of the Drosophila gene capicua) on chromosome 19q was somatically mutated in six cases and that the FUBP1 gene [encoding far-upstream element (FUSE) binding protein] on chromosome 1p was somatically mutated in two tumors. Examination of 27 additional oligodendrogliomas revealed 12 and 3 more tumors with mutations of CIC and FUBP1, respectively, 58% of which were predicted to result in truncations of the encoded proteins. These results suggest a critical role for these genes in the biology and pathology of oligodendrocytes.

Afro-Derived Brazilian Populations: Male Genetic Constitution Estimated by Y-Chromosomes STRs and AluYAP Element Polymorphisms

The genetic constitution of Afro-derived Brazilian populations is barely studied. To improve that knowledge, we investigated the AluYAP element and five Y-chromosome STRs (DYS19, DYS390, DYS391, DYS392, and DYS393) to estimate ethnic male contribution in the constitution of four Brazilian quilombos remnants: Mocambo, Rio das Ras, Kalunga, and Riacho de Sacutiaba. Results indicated significant differences among communities, corroborating historical information about the Brazilian settlement. We concluded that besides African contribution, there was a great European participation in the constitution of these four populations and that observed haplotype variability could be explained by gene flow to quilombos remnants and mutational events in microsatellites (STRs). Am. J. Hum. Biol. 21:354-356, 2009. (C) 2009 Wiley-Liss, Inc.

Linkage of Paget disease of bone to a novel region on human chromosome 18q23

Paget disease of bone (PDB) is characterized by increased osteoclast activity and localized abnormal bone remodeling. PDB has a significant genetic component, with evidence of linkage to chromosomes 6p21.3 (PDB1) and 18q21-22 (PDB2) in some pedigrees. There is evidence of genetic heterogeneity, with other pedigrees showing negative linkage to these regions. TNFRSF11A, a gene that is essential for osteoclast formation and that encodes receptor activator of nuclear factor-kappa B (RANK), has been mapped to the PDB2 region. TNFRSF11A mutations that segregate in pedigrees with either familial expansile osteolysis or familial PDB have been identified; however, linkage studies and mutation screening have excluded the involvement of RANK in the majority of patients with PDB. We have excluded linkage, both to PDB1 and to PDB2, in a large multigenerational pedigree with multiple family members affected by PDB. We have conducted a genomewide scan of this pedigree, followed by fine mapping and multipoint analysis in regions of interest. The peak two-point LOD scores from the genomewide scan were 2.75, at D7S507, and 1.76, at D18S70. Multipoint and haplotype analysis of markers flanking D7S507 did not support linkage to this region. Haplotype analysis of markers flanking D18S70 demonstrated a haplotype segregating with PDB in a large subpedigree. This subpedigree had a significantly lower age at diagnosis than the rest of the pedigree (51.2 +/- 8.5 vs. 64.2 +/- 9.7 years; P = .0012). Linkage analysis of this subpedigree demonstrated a peak two-point LOD score of 4.23, at marker D18S1390 (theta = 0), and a peak multipoint LOD score of 4.71, at marker D18S70. Our data are consistent with genetic heterogeneity within the pedigree and indicate that 18q23 harbors a novel susceptibility gene for PDB.

Reverse transcriptase activity and untranslated region sharing of a new RTE-like, non-long terminal repeat retrotransposon from the human blood fluke, Schistosoma japonicum

A new RTE-like, non-long terminal repeat retrotransposon, termed SjR2, from the human blood fluke, Schistosoma japonicum, is described. SjR2 is similar to3.9 kb in length and is constituted of a single open reading frame encoding a polyprotein with apurinic/apyrimidinic endonuclease and reverse transcriptase domains. The open reading frame is bounded by 5'- and 3'-terininal untranslated regions and, at its 3-terminus, SjR2 bears a short (TGAC)(3) repeat. Phylogenetic analyses based on conserved domains of reverse transcriptase or endonuclease revealed that SjR2 belonged to the RTE clade of non-long terminal repeat retrotransposons. Further, SjR2 was homologous, but probably not orthologous, to SR2 front the African blood fluke, Schistosoma mansoni; this RTE-like family of non-long terminal repeat retrotransposons appears to have arisen before the divergence of the extant schistosome species. Hybridisation analyses indicated that similar to 10,000 copies of SjR2 were dispersed throughout the S. japonicum chromosomes, accounting for up to 14% of the nuclear genome. Messenger RNAs encoding the reverse transcriptase and endonuclease domains of SjR2 were detected in several developmental stages of the schistosome, indicating that the retrotransposon was actively replicating within the genome of the parasite. Exploration of the coding and non-coding regions of SjR2 revealed two notable characteristics. First, the recombinant reverse transcriptase domain of SjR2 expressed in insect cells primed reverse transcription of SjR2 mRNA in vitro. By contrast, recombinant SjR2-endonuclease did not appear to cleave schistosome or plasmid DNA. Second, the 5'-untranslated region of SjR2 was >80% identical to the 3-untranslated region of a schistosome heat shock protein-70 gene (hsp-70) in the antisense orientation, indicating that SjR2-like elements were probably inserted into the non-coding regions of ancestral S. japonicum HSP-70, probably after the species diverged from S. mansoni. (C) 2002 Australian Society for Parasitology Inc. Published by Elsevier Science Ltd. All rights reserved.

Wavelet analysis of human DNA

This paper studies the human DNA in the perspective of signal processing. Six wavelets are tested for analyzing the information content of the human DNA. By adopting real Shannon wavelet several fundamental properties of the code are revealed. A quantitative comparison of the chromosomes and visualization through multidimensional and dendograms is developed.

Sequencing of a 17.6 kb segment on the right arm of yeast chromosome VII reveals 12 ORFs, including CCT, ADE3 and TR-I genes, homologues of the yeast PMT and EF1G genes, of the human and bacterial electron-transferring flavoproteins (beta-chain) and of the Escherichia coli phosphoserine phosphohydrolase, and five new ORFs.

A 17.6 kb DNA fragment from the right arm of chromosome VII of Saccharomyces cerevisiae has been sequenced and analysed. The sequence contains twelve open reading frames (ORFs) longer than 100 amino acids. Three genes had already been cloned and sequenced: CCT, ADE3 and TR-I. Two ORFs are similar to other yeast genes: G7722 with the YAL023 (PMT2) and PMT1 genes, encoding two integral membrane proteins, and G7727 with the first half of the genes encoding elongation factors 1gamma, TEF3 and TEF4. Two other ORFs, G7742 and G7744, are most probably yeast orthologues of the human and Paracoccus denitrificans electron-transferring flavoproteins (beta chain) and of the Escherichia coli phosphoserine phosphohydrolase. The five remaining identified ORFs do not show detectable homology with other protein sequences deposited in data banks. The sequence has been deposited in the EMBL data library under Accession Number Z49133.

Annotating the human genome

2 Abstract2.1 En françaisLe séquençage du génome humain est un pré-requis fondamental à la compréhension de la biologie de l'être humain. Ce projet achevé, les scientifiques ont dû faire face à une tâche aussi importante, comprendre cette suite de 3 milliards de lettres qui compose notre génome. Le consortium ENCODE (ENCyclopedia Of Dna Elements) fût formé comme une suite logique au projet du génome humain. Son rôle est d'identifier tous les éléments fonctionnels de notre génome incluant les régions transcrites, les sites d'attachement des facteurs de transcription, les sites hypersensibles à la DNAse I ainsi que les marqueurs de modification des histones. Dans le cadre de ma thèse doctorale, j'ai participé à 2 sous-projets d'ENCODE. En premier lieu, j'ai eu la tâche de développer et d'optimiser une technique de validation expérimentale à haut rendement de modèles de gènes qui m'a permis d'estimer la qualité de la plus récente annotation manuelle. Ce nouveau processus de validation est bien plus efficace que la technique RNAseq qui est actuellement en train de devenir la norme. Cette technique basée sur la RT-PCR, m'a notamment permis de découvrir de nouveaux exons dans 10% des régions interrogées. En second lieu j'ai participé à une étude ayant pour but d'identifier les extrémités de tous les gènes des chromosomes humains 21 et 22. Cette étude à permis l'identification à large échelle de transcrits chimères comportant des séquences provenant de deux gènes distincts pouvant être à une grande distance l'un de autre.2.2 In EnglishThe completion of the human genome sequence js the prerequisite to fully understand the biology of human beings. This project achieved, scientists had to face another challenging task, understanding the meaning of the 3 billion letters composing this genome. As a logical continuation of the human genome project, the ENCODE (ENCyclopedia Of DNA Elements) consortium was formed with the aim of annotating all its functional elements. These elements include transcribed regions, transcription binding sites, DNAse I hypersensitive sites and histone modification marks. In the frame of my PhD thesis, I was involved in two sub-projects of ENCODE. Firstly I developed and optimized an high throughput method to validate gene models, which allowed me to assess the quality of the most recent manually-curated annotation. This novel experimental validation pipeline is extremely effective, far more so than transcriptome profiling through RNA sequencing, which is becoming the norm. This RT-PCR-seq targeted-approach is likewise particularly efficient in identifying novel exons, as we discovered about 10% of loci with unannotated exons. Secondly, I participated to a study aiming to identify the gene boundaries of all genes in the human chromosome 21 and 22. This study led to the identification of chimeric transcripts that are composed of sequences coming form two distinct genes that can be map far away from each other.

Separation and Mapping of Chromosomes of Parasitic Protozoa

Many protozoan parasites represent an important group of human pathogens. Pulsed Field Gradient Gel Electrophoresis (PFGE) analysis has been an important tool for fundamental genetic studies of parasites like Trypanosoma, Leishmania, Giardia or the human malaria parasite Plasmodium falciparum. We present PFGE conditions allowing a high resolution separation of chromosomes ranging from 500 to 4000 kb within a two day electrophoresis run. In addition, we present conditions for separating large chromosomes (2000-6000 kb) within 36 hr. We demontrate that the application of two dimentional PFGE (2D-PFGE) technique to parasite karyotypes is a very useful method for the analysis of dispersed gene families and comparative studies of the intrachomosomal genome organization

Nineteen additional unpredicted transcripts from human chromosome 21.

The identification of all human chromosome 21 (HC21) genes is a necessary step in understanding the molecular pathogenesis of trisomy 21 (Down syndrome). The first analysis of the sequence of 21q included 127 previously characterized genes and predicted an additional 98 novel anonymous genes. Recently we evaluated the quality of this annotation by characterizing a set of HC21 open reading frames (C21orfs) identified by mapping spliced expressed sequence tags (ESTs) and predicted genes (PREDs), identified only in silico. This study underscored the limitations of in silico-only gene prediction, as many PREDs were incorrectly predicted. To refine the HC21 annotation, we have developed a reliable algorithm to extract and stringently map sequences that contain bona fide 3' transcript ends to the genome. We then created a specific 21q graphical display allowing an integrated view of the data that incorporates new ESTs as well as features such as CpG islands, repeats, and gene predictions. Using these tools we identified 27 new putative genes. To validate these, we sequenced previously cloned cDNAs and carried out RT-PCR, 5'- and 3'-RACE procedures, and comparative mapping. These approaches substantiated 19 new transcripts, thus increasing the HC21 gene count by 9.5%. These transcripts were likely not previously identified because they are small and encode small proteins. We also identified four transcriptional units that are spliced but contain no obvious open reading frame. The HC21 data presented here further emphasize that current gene prediction algorithms miss a substantial number of transcripts that nevertheless can be identified using a combination of experimental approaches and multiple refined algorithms.

Gene expression variation and expression quantitative trait mapping of human chromosome 21 genes.

Inter-individual differences in gene expression are likely to account for an important fraction of phenotypic differences, including susceptibility to common disorders. Recent studies have shown extensive variation in gene expression levels in humans and other organisms, and that a fraction of this variation is under genetic control. We investigated the patterns of gene expression variation in a 25 Mb region of human chromosome 21, which has been associated with many Down syndrome (DS) phenotypes. Taqman real-time PCR was used to measure expression variation of 41 genes in lymphoblastoid cells of 40 unrelated individuals. For 25 genes found to be differentially expressed, additional analysis was performed in 10 CEPH families to determine heritabilities and map loci harboring regulatory variation. Seventy-six percent of the differentially expressed genes had significant heritabilities, and genomewide linkage analysis led to the identification of significant eQTLs for nine genes. Most eQTLs were in trans, with the best result (P=7.46 x 10(-8)) obtained for TMEM1 on chromosome 12q24.33. A cis-eQTL identified for CCT8 was validated by performing an association study in 60 individuals from the HapMap project. SNP rs965951 located within CCT8 was found to be significantly associated with its expression levels (P=2.5 x 10(-5)) confirming cis-regulatory variation. The results of our study provide a representative view of expression variation of chromosome 21 genes, identify loci involved in their regulation and suggest that genes, for which expression differences are significantly larger than 1.5-fold in control samples, are unlikely to be involved in DS-phenotypes present in all affected individuals.