Lexington, Massachusetts, 1830 (Raster Image)

This layer is a georeferenced raster image of the historic paper map entitled: Plan of the town of Lexington in the county of Middlesex, from a survey made by John G. Hales in Augt. 1830. It was published by Pendleton's Lithogy. Scale [1:19,800]. The image inside the map neatline is georeferenced to the surface of the earth and fit to the Massachusetts State Plane Coordinate System, Mainland Zone (in Feet) (Fipszone 2001). All map collar and inset information is also available as part of the raster image, including any inset maps, profiles, statistical tables, directories, text, illustrations, or other information associated with the principal map. This map shows features such as roads, drainage, public buildings, schools, churches, cemeteries, industry locations (e.g. mills, factories, mines, etc.), private buildings with names of property owners, town boundaries and more. Relief is shown by hachures. This layer is part of a selection of digitally scanned and georeferenced historic maps of Massachusetts from the Harvard Map Collection. These maps typically portray both natural and manmade features. The selection represents a range of regions, originators, ground condition dates (1755-1922), scales, and purposes. The digitized selection includes maps of: the state, Massachusetts counties, town surveys, coastal features, real property, parks, cemeteries, railroads, roads, public works projects, etc.

Marion, Massachusetts, 1855 (Raster Image)

This layer is a georeferenced raster image of the historic paper map entitled: Map of the town of Marion, Plymouth County, Mass., by H.F. Walling, supt. of the state map. It was published in 1855. Scale [1:12,672]. The image inside the map neatline is georeferenced to the surface of the earth and fit to the Massachusetts State Plane Coordinate System, Mainland Zone (in Feet) (Fipszone 2001). All map collar and inset information is also available as part of the raster image, including any inset maps, profiles, statistical tables, directories, text, illustrations, or other information associated with the principal map. This map shows features such as roads, railroads, drainage, public buildings, schools, churches, cemeteries, industry locations (e.g. mills, factories, mines, etc.), private buildings with names of property owners, town boundaries and more. Relief is shown by hachures; harbor depths are shown by soundings and contours. Includes 4 vignettes of town buildings and insets: Sippican Village. Scale [1:4,950] -- Old Landing. Scale [1:4,950]. This layer is part of a selection of digitally scanned and georeferenced historic maps of Massachusetts from the Harvard Map Collection. These maps typically portray both natural and manmade features. The selection represents a range of regions, originators, ground condition dates (1755-1922), scales, and purposes. The digitized selection includes maps of: the state, Massachusetts counties, town surveys, coastal features, real property, parks, cemeteries, railroads, roads, public works projects, etc.

Stow (including part of Maynard), Massachusetts, 1830 (Raster Image)

This layer is a georeferenced raster image of the historic paper map entitled: Plan of the town of Stow, surveyed by Augustus Tower in 1830. It was published by Pendleton's Lithography in 1830. Scale [1:19,800]. The image inside the map neatline is georeferenced to the surface of the earth and fit to the Massachusetts State Plane Coordinate System, Mainland Zone (in Feet) (Fipszone 2001). All map collar and inset information is also available as part of the raster image, including any inset maps, profiles, statistical tables, directories, text, illustrations, or other information associated with the principal map. This map shows features such as roads, drainage, public buildings, schools, churches, cemeteries, industry locations (e.g. mills, factories, mines, etc.), private buildings with names of property owners, town and school district boundaries and more. Relief is shown by hachures. The map shows town boundaries as of 1830 and thus covers also a portion of the town of Maynard. This layer is part of a selection of digitally scanned and georeferenced historic maps of Massachusetts from the Harvard Map Collection. These maps typically portray both natural and manmade features. The selection represents a range of regions, originators, ground condition dates (1755-1922), scales, and purposes. The digitized selection includes maps of: the state, Massachusetts counties, town surveys, coastal features, real property, parks, cemeteries, railroads, roads, public works projects, etc.

History of La Grange military academy and the cadet corps, 1857-1862, La Grange college, 1830-1857,

Mode of access: Internet.

Das Mädchen von Treppi ; und, Marion /

Mode of access: Internet.

Le genre de la pauvreté : l'assistance aux indigents à Sherbrooke de 1922 à 1940

Le problème de la pauvreté au Québec n'est pas un fait inhérent à notre société contemporaine. Déjà, sous le Régime français, la colonie avait dû faire face à divers malaises sociaux dont notamment la pauvreté. Pour tenter de les endiguer, les dirigeants de la colonie se servirent du modèle d'assistance français, datant du 17e siècle, sous influence féodale et ecclésiale, pour le reproduire en Nouvelle-France. Ainsi, aux 17e et 18e siècles, la responsabilité des malades et des pauvres incomba aux réseaux de solidarité que constituaient la famille et la paroisse. Durant cette période, l'action de l'Église, grâce à des institutions telles que les Hôtels-Dieu et les hôpitaux généraux et celle de l'État, par sa politique subventionnaire, ne constituèrent toutefois qu'une intervention supplétive. Cependant, les débuts de l'industrialisation au 19e siècle, l'exode rural qui s'ensuivit ainsi que l'instabilité économique et l'immigration des populations britanniques, révélèrent l'insuffisance de la structure d'aide mise en place pour secourir les pauvres et les malades. Fondées à partir de 1830, différentes associations charitables se confrontèrent, elles aussi, à des problèmes d'ordre financier. À cause de sa situation névralgique comme institution sociale, l'Église s'assura graduellement, à partir de 1840, le contrôle des associations de charité mais surtout celui de l'administration de l'assistance au Québec. Et comme le dit si bien Jean-Marie Fecteau: «la charité devient, de plus en plus, affaire de religion et de groupe ethnique. Au cours de la décennie 1840, le mouvement s'amplifie.» En 1867, l'Acte de l'Amérique du Nord britannique attribua à la province de Québec, par l'article 92, la pleine juridiction en matière de bien-être et de santé sauf ce qui concerne les hôpitaux de la marine. La reformulation du code municipal en 1871 conféra aux municipalités, mais seulement à titre discrétionnaire, la charge de l'assistance directe et celle de soutenir les institutions de charité. [...]

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Description of the pupal case of Systropus (Systropus) nitidus Wiedemann, 1830 (Diptera, Bombyliidae, Toxophorinae, Systropodini)

The pupal case of Systropus (Systropus) nitidus Wiedemann reared from an unidentified tipical Limacodidae (Lepidoptera) cocoon is described and illustrated for the first time. Only species of Limacodidae are recorded as host of the immature stages of S. (Systropus). The geographical distribution of S. (Systropus) nitidus is restricted to Brazil, from Pará to Santa Catarina states. This is the first pupal case description and illustration of a Neotropical species of the subgenus Systropus.

Cytogenetic analysis of Astylus antis (Perty, 1830) (Coleoptera, Melyridae): Karyotype, heterochromatin and location of ribosomal genes

Cytogenetic analysis of Astylus antis using mitotic and meiotic cells was performed to characterize the haploid and diploid numbers, sex determination system, chromosome morphology, constitutive heterochromatin distribution pattern and chromosomes carrying nucleolus organizer regions (NORs). Analysis of spermatogonial metaphase cells revealed the diploid number 2n = 18, with mostly metacentric chromosomes. Metaphase I cells exhibited 2n = 8II+Xyp and a parachute configuration of the sex chromosomes. Spermatogonial metaphase cells submitted to C-banding showed the presence of small dots of constitutive heterochromatin in the centromeric regions of nearly all the autosomes and on the short arm of the X chromosome (Xp), as well as an additional band on one of the arms of pair 1. Mitotic cells submitted to double staining with base-specific fluorochromes (DAPI-CMA3) revealed no regions rich in A+T or G+C sequences. Analysis of spermatogonial mitotic cells after sequential Giemsa/AgNO3 staining did not reveal any specific mark on the chromosomes. Meiotic metaphase I cells stained with silver nitrate revealed a strong impregnation associated to the sex chromosomes, and in situ hybridization with an 18S rDNA probe showed ribosomal cistrons in an autosomal bivalent.

O Brasil, os imigrantes italianos e a política externa fascista, 1922-1943

O artigo busca delimitar os objetivos da Itália fascista no Brasil e fazer um balanço das relações entre os dois países no período entre as duas guerras. O argumento central gira em torno da política migratória italiana e da aproximação dos agentes e agências fascistas no Brasil aos imigrantes de origem italiana e seus descendentes.

Infecção experimental de Calomys callosus (Rengger, 1830), (Cricetidae - Rodentia) a quatro espécies de parasitos

Neste trabalho foram estudados exemplares do roedor, Calomys callosus, nascidos em laboratório, a infecções experimentais com quatro parasitos: Plasmodium berghei, Leishmania mexicana amazonensis, Schistosoma mansoni e Hymenolepsis nana. A positividade das infecções foi de 80% para os três primeiros parasitos e 0 para H. nana. C. callosus é um roedor de excelente adaptação em laboratório e de fácil manuseio. Acredita-se que, de acordo com os resultados obtidos neste trabalho, este animal poderia ser um bom modelo experimental de laboratório para certos agentes patogênicos.