Modeling The Effects Of Temperature And Ph On The Resistance Of Alicyclobacillus Acidoterrestris In Conventional Heat-treated Fruit Beverages Through A Meta-analysis Approach.

In this work, all publicly-accessible published findings on Alicyclobacillus acidoterrestris heat resistance in fruit beverages as affected by temperature and pH were compiled. Then, study characteristics (protocols, fruit and variety, °Brix, pH, temperature, heating medium, culture medium, inactivation method, strains, etc.) were extracted from the primary studies, and some of them incorporated to a meta-analysis mixed-effects linear model based on the basic Bigelow equation describing the heat resistance parameters of this bacterium. The model estimated mean D* values (time needed for one log reduction at a temperature of 95 °C and a pH of 3.5) of Alicyclobacillus in beverages of different fruits, two different concentration types, with and without bacteriocins, and with and without clarification. The zT (temperature change needed to cause one log reduction in D-values) estimated by the meta-analysis model were compared to those ('observed' zT values) reported in the primary studies, and in all cases they were within the confidence intervals of the model. The model was capable of predicting the heat resistance parameters of Alicyclobacillus in fruit beverages beyond the types available in the meta-analytical data. It is expected that the compilation of the thermal resistance of Alicyclobacillus in fruit beverages, carried out in this study, will be of utility to food quality managers in the determination or validation of the lethality of their current heat treatment processes.

Malpighiaceae: correlations between habit, fruit type and basic chromosome number

The family Malpighiaceae presents species with different habits, fruit types and cytological characters. Climbers are considered the most derived habit, followed, respectively, by the shrubby and arboreal ones. The present study examines the relationship between basic chromosome numbers and the derivation of climbing habit and fruit types in Malpighiaceae. A comparison of all the chromosome number reports for Malpighiaceae showed a predominance of chromosome numbers based on x=5 or 10 in the genera of sub-family Malpighioideae, mainly represented by climbers with winged fruits, whereas non-climbing species with non-winged fruits, which predominate in sub-family Byrsonimoideae, had counts based on x=6, which is considered the less derived basic number for the family. Based on such data, confirmed by statistic assays, and on the monophyletic origin of this family, we admit the hypothesis that morphological derivation of habit and fruit is correlated with chromosome basic number variation in the family Malpighiaceae.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Production and body composition traits of broilers in relation to breast weight evaluated by path analysis

Breast weight has great economic importance in poultry industry, and may be associated with other variables. This work aimed to estimate phenotypic correlations between performance (live body weight at 7 and 28 days, and at slaughter, and depth of the breast muscle measured by ultrasonography), carcass (eviscerated body weight and leg weight) and body composition (heart, liver and abdominal fat weight) traits in a broiler line, and quantify the direct and indirect influence of these traits on breast weight. Path analysis was used by expanding the matrix of partial correlation in coefficients which give the direct influence of one trait on another, regardless the effect of the other traits. The simultaneous maintenance of live body weight at slaughter and eviscerated body weight in the matrix of correlations might be harmful for statistical analysis involving systems of normal equations, like path analysis, due to the observed multicollinearity. The live body weight at slaughter and the depth of the breast muscle as measured by ultrasonography directly affected breast weight and were identified as the most responsible factors for the magnitude of the correlation coefficients obtained between the studied traits and breast weight. Individual pre-selection for these traits could favor an increased breast weight in the future reproducer candidates of this line if the broilers' environmental conditions and housing are maintained, since the live body weight at slaughter and the depth of breast muscle measured by ultrasonography were directly related to breast weight.

Phenotypic correlations among meat quality traits in broilers

The goals of this research were to estimate the phenotypic correlations among various meat quality traits from a male broiler line and to describe the relation among these variables. Phenotypical correlations were determined among quality traits, isolating the effects of slaughter date, the age of the mother and sex. The evaluated traits were pH measurements taken at time 0 and at 6 and 24 hours after slaughtering, color parameters, water loss due to exudation, thawing and cooking of the meat, and shear force. Important associations (P<0.01) were found to be significant and, in most cases, weak or moderate, varying from -0.35 to 0.28. The initial pH of the meat was not associated (P>0.05) to the other traits of the meat, whereas the pH at 24 hours after slaughter was able of directly interfering with the attributes of the meat, since this trait was inversely related with lightness and water losses, which indicates an effect of pH fall along 24h after slaughtering on protein denaturation. This study demonstrates that the variables of poultry meat quality are related and that there is a phenotypical association between lightness and cooking losses and the other attributes of the meat. The pH at 24 hours after slaughtering, lightness and cooking losses could be efficient meat quality indicators in this broiler line.

Dynamic and steady: shear rheological properties of xanthan and guar gums dispersed in yellow passion fruit pulp (Passiflora edulis f. flavicarpa)

Yellow passion fruit pulp is unstable, presenting phase separation that can be avoided by the addition of hydrocolloids. For this purpose, xanthan and guar gum [0.3, 0.7 and 1.0% (w/w)] were added to yellow passion fruit pulp and the changes in the dynamic and steady - shear rheological behavior evaluated. Xanthan dispersions showed a more pronounced pseudoplasticity and the presence of yield stress, which was not observed in the guar gum dispersions. Cross model fitting to flow curves showed that the xanthan suspensions also had higher zero shear viscosity than the guar suspensions, and, for both gums, an increase in temperature led to lower values for this parameter. The gums showed different behavior as a function of temperature in the range of 5 - 35ºC. The activation energy of the apparent viscosity was dependent on the shear rate and gum concentration for guar, whereas for xanthan these values only varied with the concentration. The mechanical spectra were well described by the generalized Maxwell model and the xanthan dispersions showed a more elastic character than the guar dispersions, with higher values for the relaxation time. Xanthan was characterized as a weak gel, while guar presented a concentrated solution behavior. The simultaneous evaluation of temperature and concentration showed a stronger influence of the polysaccharide concentration on the apparent viscosity and the G' and G" moduli than the variation in temperature.

Wives of pathological gamblers: personality traits, depressive symptoms and social adjustment

Objective: Wives of pathological gamblers tend to endure long marriages despite financial and emotional burden. Difficulties in social adjustment, personality psychopathology, and comorbidity with psychiatric disorders are pointed as reasons for remaining on such overwhelming relationships. The goal was to examine the social adjustment, personality and negative emotionality of wives of pathological gamblers. Method: The sample consisted of 25 wives of pathological gamblers, mean age 40.6, SD = 9.1 from a Gambling Outpatient Unit and at GAM-ANON, and 25 wives of non-gamblers, mean age 40.8, SD = 9.1, who answered advertisements placed at the Universidade de São Paulo hospital and medical school complex. They were selected in order to approximately match demographic characteristics of the wives of pathological gamblers. Subjects were assessed by the Social Adjustment Scale, Temperament and Character Inventory, Beck Depression Inventory and State-Trait Anxiety Inventory. Results: Three variables remained in the final Multiple Logistic Regression model, wives of pathological gamblers presented greater dissatisfaction with their marital bond, and higher scores on Reward Dependence and Persistence temperament factors. Both, Wives of pathological gamblers and wives of non-gamblers presented well-structured character factors excluding personality disorders. Conclusion: This personality profile may explain wives of pathological gamblers emotional resilience and their marriage longevity. Co-dependence and other labels previously used to describe them may work as a double edged sword, legitimating wives of pathological gamblers problems, while stigmatizing them as inapt and needy.

Stability of fruit bases and chocolate fillings

Syrups with high sugar content and dehydrated fruits in its composition can be added to chocolate fillings to reduce the need of artificial flavor and dyes attributing a natural appeal to the product. Fruit bases were produced with lyophilized strawberry, passion fruit, and sliced orange peel. Rheological dynamic oscillatory tests were applied to determine the products stability and tendency of shelf life. Values of G´< G´´ were observed for strawberry and passion fruit flavor, whereas values of G´ > G´´ were found for orange flavor during the 90 days of storage. It was observed that shear stress values did not vary significantly suggesting product stability during the studied period. For all fillings, it was found a behavior similar to the fruit base indicating that it has great influence on the filling behavior and its stability. The use of a sugar matrix in fillings provided good shelf life for the fruit base, which could be kept under room temperature conditions for a period as long as one year. The good stability and storage conditions allow the use of fruit base for handmade products as well as for industrialized products.

OFFSPRING IN RESPONSE TO PARENTAL FEMALE DENSITIES IN THE FRUIT FLY PARASITOID DIACHASMIMORPHA LONGICAUDATA (HYMENOPTERA: BRACONIDAE: OPIINAE)

As part of an evaluation of the braconid parasitoid Diachasmimorpha longicaudata (Ashmead) as a biocontrol agent of Ceratitis capitata (Wiedemann) in Brazil, the aims in the current study were to find the best parental ratio of females to males in the rearing cages in order to get the highest female biased offspring in the parasitoid rearing process, and to verify the parasitism efficiency on C. capitata according to parental female densities. Three treatments were assessed: T1 (20 females: 20 males), T2 (60 females: 20 males) and T3 (100 females: 20 males). Ten late-third instars of C. capitata were offered daily to each female parasitoid from the 1st to the 12th d of age. The parental female productivity, fecundity, offspring sex ratio, percentage of parasitoid emergence, and daily mortality of parental females and males at different female/male densities were evaluated. The results indicated that numbers higher than 20 parental females did not affect offspring sex ratio, overall offspring production, nor the percent parasitism. Female biased offspring occurred in all three parental female/male ratios analyzed in this study, except that predominately males developed from parasitoid eggs laid in the age interval 1-2 d post emergence. Higher parasitoid female productivity and fecundity were found at the 1:1 female/male per cage density whereas lower productivity and fecundity were recorded at the 5:1 female/male ratio. Higher female/male ratio in the parental cages increased the mortality rate of females but did not influence the number of parental male deaths. The results may facilitate advancement of an optimum mass-rearing system to aid in control of C. capitata in Brazil.

Convergence of developmental mutants into a single tomato model system: 'Micro-Tom' as an effective toolkit for plant development research

Background: The tomato (Solanum lycopersicum L.) plant is both an economically important food crop and an ideal dicot model to investigate various physiological phenomena not possible in Arabidopsis thaliana. Due to the great diversity of tomato cultivars used by the research community, it is often difficult to reliably compare phenotypes. The lack of tomato developmental mutants in a single genetic background prevents the stacking of mutations to facilitate analysis of double and multiple mutants, often required for elucidating developmental pathways. Results: We took advantage of the small size and rapid life cycle of the tomato cultivar Micro-Tom (MT) to create near-isogenic lines (NILs) by introgressing a suite of hormonal and photomorphogenetic mutations (altered sensitivity or endogenous levels of auxin, ethylene, abscisic acid, gibberellin, brassinosteroid, and light response) into this genetic background. To demonstrate the usefulness of this collection, we compared developmental traits between the produced NILs. All expected mutant phenotypes were expressed in the NILs. We also created NILs harboring the wild type alleles for dwarf, self-pruning and uniform fruit, which are mutations characteristic of MT. This amplified both the applications of the mutant collection presented here and of MT as a genetic model system. Conclusions: The community resource presented here is a useful toolkit for plant research, particularly for future studies in plant development, which will require the simultaneous observation of the effect of various hormones, signaling pathways and crosstalk.

Genetic trend estimates of meat quality traits in a male broiler line

The present research was conducted to estimate the genetic trends for meat quality traits in a male broiler line. The traits analyzed were initial pH, pH at 6 h after slaughter, final pH, initial range of falling pH, final range of falling pH, lightness, redness, yellowness, weep loss, drip loss, shrink loss, and shear force. The number of observations varied between 618 and 2125 for each trait. Genetic values were obtained by restricted maximum likelihood, and the numerator relationship matrix had 107,154 animals. The genetic trends were estimated by regression of the broiler average genetic values with respect to unit of time (generations), and the average genetic trend was estimated by regression coefficients. Generally, for the traits analyzed, small genetic trends were obtained, except for drip loss and shear force, which were higher. The small magnitude of the trends found could be a consequence of the absence of selection for meat quality traits in the line analyzed. The estimates of genetic trends obtained were an indication of an improvement in the meat quality traits in the line analyzed, except for drip loss.

Determination of banana fruit susceptibility to post-harvest diseases: wound anthracnose, quiescent anthracnose and crown rot

Introduction. This protocol aims at ( a) evaluating the resistance to post-harvest diseases within different genotypes of bananas, and ( b) comparing different origins of bananas ( geographic origin, physiological stage, etc.) for their susceptibility to post-harvest diseases. The principle, key advantages, starting plant material, time required and expected results are presented. Materials and methods. Materials required and details of the twelve steps of the protocol ( fruit sampling and inoculum preparation, wound anthracnose resistance study, quiescent anthracnose resistance study and crown-rot resistance study) are described. Results. Typical symptoms of the different diseases are obtained after artificial inoculation.

Biochemical characterization of pulp of banana fruit: measurement of soluble sugars, organic acids, free ACC and in vitro ACC oxidase

Introduction. We present some protocols aiming at partially characterizing banana fruit quality through measurement of some key biochemical parameters. The principle, key advantages, starting plant material, time required and expected results are presented. Materials and methods. This part describes the required laboratory materials and the steps necessary for achieving four protocols making it possible to measure sugar, organic acids and free ACC contents, and in vitro ACC oxidase activity. Results. Standard results obtained by using the protocols described are presented in the figures.